ࡱ > bjbj,(,( . NB NB MZ l <
% ~ X z h D $ $ $ $ $ $ $ $ , & =) F$ F$ $ x $ #ʨ v d $ 0
% ) ) T F$ F$
% ) :
SI Materials and Methods
Genotypes
Genotypes: TIGS>+: +;+;TIGS-2/+, TIGS>ndi1: +;UAS-ndi1/+;TIGS-2/+, esgGAL4>+: +;esgGAL4,UAS-gfp/+;+, esgGAL4>ndi1: +;esgGAL4,UAS-gfp/UAS-ndi1;+, 5961GS>+: +;5961GS,UAS-gfp/+;+, 5961GS>ndi1: +;5961GS,UAS-gfp/UAS-ndi1;+, 5966GS>+: +;5966GS/+;+, 5966GS>ndi1: +;5966GS/UAS-ndi1;+
Fly Media
Unless otherwise noted solid food media provided to flies contained 1% agar, 3% yeast, 1.9% sucrose, 3.8% dextrose, 9.1% cornmeal, 1.5% methylparaben, and 1% acid mix wt/vol. For RU486 and control media, a stock solution of RU486 (Cayman Chemicals, Ann Arbor, MI, USA) or ethanol was mixed into the media to specified concentrations after cooling to approximately 65C.
Lifespan Analysis
Flies that eclosed over a 24-36 hour period were collected and allowed to mate for approximately 60 hours. Female or male flies were collected under light nitrogen-induced anesthesia and maintained at a density of 30 flies per vial in a humidified, temperature-controlled (25C) incubator with a 12 hour light-dark cycle. Flies were transferred to new vials every 2-3 days and scored for death.
Mitochondrial Isolation
Fly guts were dissected on ice on ice-cold 1XPBS, and mitochondria were purified by differential centrifugation. Dissected guts were homogenized in chilled mitochondrial isolation medium (MIM, 250 mM sucrose, 10 mM Tris (pH 7.4), 0.15 mM MgCl2) and debris was pelleted by centrifugation (500g, 5 min at 4C). Mitochondria were pelleted by centrifugation (5,000g, 5 min at 4C) and stored a t "8 0 C .
N A D H : U b i q u i n o n e O x i d o r e d u c t a s e A c t i v i t y A s s a y
P r e p a r e d m i t o c h o n d r i a w e r e r e s u s p e n d e d i n M I M a n d a d d e d t o 1 5 0 l o f a c o l o r i m e t r i c c o m p l e x I a c t i v i t y a s s a y b u f f e r ( 1 P B S , 3 . 5 g / l B S A , 0 . 2 m M N A D H , 0 . 2 4 m M K C N , 6 0 M D C I P , 7 0 M d e c y l u b i q u i n o n e , 25 mM antimycin A). NADH:ubiquinone oxidoreductase activity was monitored as a drop in DCIP absorbance at 600 nm using an Epoch microplate spectrophotometer (BioTek, Winooski, VT, USA). Flavone or rotenone insensitive activity was measured as the difference in DCIP reduction in the presence of flavone (0.4 mM) or rotenone (2 M) in the assay buffer, and baseline activity in an assay buffer that contained both inhibitors. All reported activities are normalized to citrate synthase activity.
Citrate Synthas e A c t i v i t y A s s a y
P r e p a r e d m i t o c h o n d r i a w e r e d i l u t e d i n t o M I M a n d a d d e d t o 1 5 0 l o f a c o l o r i m e t r i c c i t r a t e s y n t h a s e a c t i v i t y a s s a y b u f f e r ( 5 0 m M T r i s ( p H 8 . 0 ) , 0 . 1 m M 5 , 5 2 - d i t h i o b i s - ( 2 - n i t r o b e n z o i c a c i d ) ( D T N B ) , 0 . 3 m M a c e t y l - C o A , 1 m M o x a l o a c e t i c a c i d ) . Citrate synthase activity was measured as an increase in DTNB absorbance at 412 nm using an Epoch microplate spectrophotometer (BioTek).
Feeding Assays
Capillary feeding (CAFE) assays were performed as previously described ADDIN EN.CITE ADDIN EN.CITE.DATA [ HYPERLINK \l "_ENREF_1" \o "Ja, 2007 #5050" 1] with modifications. Briefly, 10 flies were placed in vials with wet tissue paper as a water source and a capillary food source (5% sucrose, 5% yeast extract, 2.5% FD&C Blue No. 1 (SPS Alfachem, Lexington, MA, USA)). Feeding was monitored from approximately 3 hours after lights on until lights off, with capillaries being replaced and feeding amounts recorded every 2-3 hours.
Dye tracking assays were performed as described previously ADDIN EN.CITE Wong20095105[2]5105510517Wong, R.Piper, M. D.Wertheim, B.Partridge, L.Institute of Healthy Ageing, and GEE, University College London, London, UK.Quantification of food intake in DrosophilaPLoS OnePloS onePLoS OnePloS onePLoS OnePloS onee6063462009/06/27AllelesAnimal FeedAnimalsCrosses, GeneticDrosophila Proteins/genetics/metabolismDrosophila melanogaster/*physiology*Feeding BehaviorFemaleIntercellular Signaling Peptides and Proteins/metabolismIntracellular Signaling Peptides and Proteins/geneticsMaleModels, Biological*MutationSpectrophotometry/methods20091932-6203 (Electronic)
1932-6203 (Linking)19557170Research Support, Non-U.S. Gov'thttp://www.ncbi.nlm.nih.gov/pubmed/19557170269814910.1371/journal.pone.0006063eng[ HYPERLINK \l "_ENREF_2" \o "Wong, 2009 #5105" 2] with slight modifications. Approximately 30 flies were placed in vials with solid media supplemented with 2.5% dye (FD&C Blue No. 1) from 3 hours after lights on until 5.5 hours after lights on at 25C. Possibly due to the low yeast concentration in our standard medium (0.3% yeast), flies required approximately 2.5 hours to show appreciable feeding. Even after 2.5 hours, significant proportions of flies still had not eaten (determined as described below), suggesting that our assay conditions were not saturating. Flies were frozen, decapitated, and homogenized separately in 200l H2O. Cell debris was pelleted via centrifugation, and absorbance (629nm) of a 1:2.5 dilution of the supernatant was used to determine whether the fly ate (flies were categorized as having eaten if they had A629nm greater than 110% of the absorbance outside of the dye absorption range, at 800nm), and if so, the relative meal size (A629-A800).
qRT-PCR
RNA isolation, cDNA synthesis, and quantitative PCR were performed on whole flies or dissected body parts as previously described ADDIN EN.CITE ADDIN EN.CITE.DATA [ HYPERLINK \l "_ENREF_3" \o "Rera, 2012 #533" 3]. Briefly, total RNA was extracted using TRIzol reagent (Life Technologies, Grand Island, NY, USA) following manufacturer protocols. Samples were treated with DNase I and used for cDNA synthesis using a Fermentas RevertAid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific, Waltham, MA, USA). Quantitative RT-PCR was performed using a Power SYBR Green PCR Master Mix (Life Technologies) in a 45 cycle reaction in a Applied Biosystems 7300 Thermal Cycler (Life Technologies). Amplicons of actin5C were used as a reference for normalization. Primer sequences: l(2)efl: CAGACGCGTTTATCCAAGTG, ATCCCACCAGTCACGGAAC, dilp1: GCTTTAATACGCTGCCAAGG, CGGATCCGTACAGATTGGTT, dilp2: ATCCCGTGATTCCACACAAG, GCGGTTCCGATATCGAGTTA, dilp3: AGAGAACTTTGGACCCCGTGA, TGAACCGAACTATCACTCAAC, dilp5: GCCTTGATGGACATGCTGA, TCATAATCGAATAGGGCCCAAG, sNPF: CCCGAAAACTTTTAGACTCA, TTTTCAAACATTTCCATCGT, sNPFR1: CTGGCCATATCGGACCTACT, GGCCAGTACTTGGACAGGAT, actin5c, drosomycin, diptericin, drosocin, InR, 4E-BP, ImpL2 primers were previously described ADDIN EN.CITE ADDIN EN.CITE.DATA [ HYPERLINK \l "_ENREF_3" \o "Rera, 2012 #533" 3].
Immunofluorescence and Cell Quantification
Fixation and staining of Drosophila midguts were carried out as previously described ADDIN EN.CITE ADDIN EN.CITE.DATA [ HYPERLINK \l "_ENREF_4" \o "Rera, 2011 #801" 4]. Midguts were co-labeled with chicken anti-GFP (1:5000, #GFP-1010, Aves Labs, Tigard, Oregon, USA) and rabbit anti-phospho-histone H3 (1:200, #06-570, EMD Millipore, Darmstadt, Germany) before mounting in Vectashield mounting medium (Vector Laboratories, Burlingame, CA, USA) containi n g 4 , 6 - d i a m i d i n o - 2 - p h e n y l i n d o l e ( D A P I ) . I m a g e s o f t h e p o s t e r i o r m i d g u t ( a p p r o x i m a t e l y 2 5 0 m a n t e r i o r t o t h e p y l o r i c r i n g ) w e r e a c q u i r e d w i t h a 2 0 x o b j e c t i v e o n a Z e i s s L S M 7 8 0 c o n f o c a l m i c r o s c o p e . C e l l s t h a t s t a i n e d f o r e i t h e r G F P , p h o s p h o - h i s t o n e H 3 ( p H H 3 + ) , o r D A P I w e r e c o u n t e d m a n u a l l y f r o m a t l e a s t 2 2 s a m p l e s p e r t r e a t m e n t g r o u p . F o r G F P + c o u n t s , O n e - w a y A N O V A w a s u s e d t o d e t e r m i n e s t a t i s t i c a l s i g n i f i c a n c e ; m e a n s o f e a c h t r e a t m e n t w e r e c o m p a r e d u s i n g T u k e y s p o s t h o c t e s t . T o d e t e r m i n e s i g n i f i c a n t differences in the median number of pHH3+ cells per posterior midgut, a Kruskall-Wallis test was used followed by a Dunns post hoc test.
Dihydroethidium (DHE) Staining
ROS levels were detected in live tissues as previously described ADDIN EN.CITE ADDIN EN.CITE.DATA [ HYPERLINK \l "_ENREF_4" \o "Rera, 2011 #801" 4]. Briefly, guts were dissected in ice-cold Schneiders medium (Caisson Labs, North Logan, UT, USA) and briefly fixed in 4% formaldehyde in Schneiders medium for 3 minutes at room te m p e r a t u r e . G u t s w e r e w a s h e d t w i c e i n S c h n e i d e r s m e d i u m f o r 3 0 s e c o n d s a n d s t a i n e d i n 5 0 M D H E ( L i f e T e c h n o l o g i e s ) i n S c h n e i d e r s m e d i u m f o r 7 m i n u t e s a t r o o m t e m p e r a t u r e i n a l i g h t p r o t e c t e d c h a m b e r . S a m p l e s w e r e w a s h e d t h r e e t i m e s f o r 5 m i n u t e s i n S c h neiders medium at room temperature, mounted in Prolong Gold with DAPI (Life Technologies), and imaged immediately at 100X magnification, 200500 m anterior to the pylorus.
Intestinal Barrier Dysfunction
Flies were tested in groups of approximately 30 per vial, as previously described ADDIN EN.CITE ADDIN EN.CITE.DATA [ HYPERLINK \l "_ENREF_3" \o "Rera, 2012 #533" 3]. Briefly, flies were transferred to solid media supplemented with 2.5% dye (FD&C Blue No. 1) for 9 hours and then checked visually under a dissecting microscope for evidence of dye outside of the gut.
Weight
Flies were weighed in groups of 5 or 10 in pre-weighed microcentrifuge tubes, using an analytical scale (Torbal, Clifton, NJ, USA).
Triacylglyceride
Lipids were extracted from whole flies in a chloroform:methanol:water solution (2:5:1 by volumes) and nonpolar lipids were separated on thin layer chromatography plates (Analtech, Newark, DE, USA) with a n-hexane:diethylether:glacial acetic acid solution (70:30:1 by volumes). Plates were air-dried, stained (0.2% Amido Black 10B in 1M NaCl), and lipid bands were quantified by photo densitometry using ImageJ as described ADDIN EN.CITE ADDIN EN.CITE.DATA [ HYPERLINK \l "_ENREF_4" \o "Rera, 2011 #801" 4].
Glycogen and Protein
Decapitated flies were homogenized in ice-cold water, cleared and used for glycogen quantification using a Glycogen Colorimetric/Fluorometric Assay Kit (BioVision, Milpitas, CA, USA) following manufacturer protocols. Protein content was quantified using a BCA kit (Thermo Fisher Scientific) following manufacturer protocols using the same clarified homogenates.
Spontaneous Activity
Spontaneous activity was measured as previously described ADDIN EN.CITE ADDIN EN.CITE.DATA [ HYPERLINK \l "_ENREF_5" \o "Bahadorani, 2010 #805" 5]. Briefly, flies were placed in a Drosophila activity meter (TriKinetics, Waltham, MA, USA) in vials at a density of 30 flies per vial. Movements were recorded continuously under normal culturing conditions for at least 24 hours on a 12 hour light-dark cycle.
Fertility
Virgin female flies were collected over a 24-hour period and matured for an additional 60 hours before mating to w1118 flies, either for a single day or continuously. Flies were transferred to new vials every 1-2 days and fertility was measured over the entire lifespan by counting total adult progeny that had eclosed from the old vials after 2 weeks at 25C. Continuously mated flies were maintained at a density of 10 females and 10 males per vial and single day mated flies were maintained at a density of 10 females per vial.
Stress Resistance
All stress assays were performed with mated female flies 10 days post eclosion at a density of 25-30 flies per vial. For hyperoxia resistance, flies were maintained in a humidified chamber maintained at 85% O2 and survival was assayed at least once per day. For heat stress resistance, flies were maintained in a humidified 37C chamber and survival was scored every 2 hours. For wet starvation, flies were maintained on water only medium (1% agar in ddH2O wt/wt) and maintained in a 25C incubator with 12 hour light-dark cycles. Survival was scored multiple times per day.
Fecal Deposit Number, Shape, and pH
Excreta assays were performed as previously described ADDIN EN.CITE ADDIN EN.CITE.DATA [ HYPERLINK \l "_ENREF_6" \o "Cognigni, 2011 #861" 6] with modifications. Flies were maintained on solid media supplemented with 0.5% bromophenol blue, sodium salt (BPB, Sigma-Aldrich, St. Louis, MO, USA) for 24 hours before the assay. Groups of 10 flies were maintained in 60X15mm petri dishes with 2ml BPB medium for 72 hours, and the center of the lid was photographed and analyzed using ImageJ ADDIN EN.CITE Schneider2012862[7]86286217Schneider, C. A.Rasband, W. S.Eliceiri, K. W.Laboratory for Optical and Computational Instrumentation, University of Wisconsin at Madison, Madison, Wisconsin, USA.NIH Image to ImageJ: 25 years of image analysisNat MethodsNature methodsNat MethodsNature methodsNat MethodsNature methods671-597*Computational Biology/history/methods/trendsHistory, 20th CenturyHistory, 21st CenturyImage Processing, Computer-Assisted/*methodsNational Institutes of Health (U.S.)Software/*history/trendsUnited States2012Jul1548-7105 (Electronic)
1548-7091 (Linking)22930834http://www.ncbi.nlm.nih.gov/pubmed/22930834[ HYPERLINK \l "_ENREF_7" \o "Schneider, 2012 #862" 7] for fecal number, shape, and hue.
Western Blot
Western blot analyses were performed using standard procedures for Polyvinylidene difluoride (PVDF) membranes using the following antibodies and dilutions: phospho-AMPK( (Thr184) (1:1000, #2535, Cell Signaling Technology, Danvers, MA, USA), beta-Actin-peroxidase (1:5000, #a3854, Sigma-Aldrich), phospho-AKT (Ser505) (1:1000, #4060, Cell Signaling Technology), phospho-AKT (Thr423) (1:1000, #2965, Cell Signaling Technology), total AKT (1:1000, #4691, Cell Signaling Technology), phospho-S6K (Thr398) (1:500, #9209, Cell Signaling Technology), total S6K (1:750, #sc-230, Santa Cruz Biotechnology, Dallas, TX, USA), rabbit IgG-peroxidase (1:2000, #a6154, Sigma-Aldrich). Densitometry and quantification were performed using ImageJ ADDIN EN.CITE Schneider2012862[7]86286217Schneider, C. A.Rasband, W. S.Eliceiri, K. W.Laboratory for Optical and Computational Instrumentation, University of Wisconsin at Madison, Madison, Wisconsin, USA.NIH Image to ImageJ: 25 years of image analysisNat MethodsNature methodsNat MethodsNature methodsNat MethodsNature methods671-597*Computational Biology/history/methods/trendsHistory, 20th CenturyHistory, 21st CenturyImage Processing, Computer-Assisted/*methodsNational Institutes of Health (U.S.)Software/*history/trendsUnited States2012Jul1548-7105 (Electronic)
1548-7091 (Linking)22930834http://www.ncbi.nlm.nih.gov/pubmed/22930834[ HYPERLINK \l "_ENREF_7" \o "Schneider, 2012 #862" 7].
DILP2 Immunofluorescence
Dissected brains were fixed, stained, and mounted following published protocols ADDIN EN.CITE Geminard2009863[8]86386317Geminard, C.Rulifson, E. J.Leopold, P.Institute for Developmental Biology and Cancer, CNRS/University of Nice-Sophia Antipolis, Parc Valrose, 06108 Nice, France.Remote control of insulin secretion by fat cells in DrosophilaCell MetabCell metabolismCell MetabCell metabolismCell MetabCell metabolism199-207103Adipocytes/*metabolismAnimalsBrain/metabolismDrosophila Proteins/*metabolismDrosophila melanogaster/*metabolismInsulin/*metabolism/secretionInsulin-Secreting Cells/metabolismIntracellular Signaling Peptides and Proteins/metabolismLarva/metabolismNeuropeptides/*metabolism2009Sep1932-7420 (Electronic)
1550-4131 (Linking)19723496http://www.ncbi.nlm.nih.gov/pubmed/1972349610.1016/j.cmet.2009.08.002[ HYPERLINK \l "_ENREF_8" \o "Geminard, 2009 #863" 8]with DILP2 antibodies provided by P. Leopold (1:800), rat IgG (#A11077, 1:250, Life Technologies), and phalloidin (#A12379, 1:100, Life Technologies). Approximately 10-20 images per brain were taken with a Zeiss CLS microscope and analyzed using ImageJ ADDIN EN.CITE Schneider2012862[7]86286217Schneider, C. A.Rasband, W. S.Eliceiri, K. W.Laboratory for Optical and Computational Instrumentation, University of Wisconsin at Madison, Madison, Wisconsin, USA.NIH Image to ImageJ: 25 years of image analysisNat MethodsNature methodsNat MethodsNature methodsNat MethodsNature methods671-597*Computational Biology/history/methods/trendsHistory, 20th CenturyHistory, 21st CenturyImage Processing, Computer-Assisted/*methodsNational Institutes of Health (U.S.)Software/*history/trendsUnited States2012Jul1548-7105 (Electronic)
1548-7091 (Linking)22930834http://www.ncbi.nlm.nih.gov/pubmed/22930834[ HYPERLINK \l "_ENREF_7" \o "Schneider, 2012 #862" 7] to measure total fluorescence of individual IPCs in slices with maximum nuclear area.
References
ADDIN EN.REFLIST 1. Ja WW, Carvalho GB, Mak EM, de la Rosa NN, Fang AY, Liong JC, Brummel T and Benzer S. Prandiology of Drosophila and the CAFE assay. Proceedings of the National Academy of Sciences of the United States of America. 2007; 104(20):8253-8256.
2. Wong R, Piper MD, Wertheim B and Partridge L. Quantification of food intake in Drosophila. PloS one. 2009; 4(6):e6063.
3. Rera M, Clark RI and Walker DW. Intestinal barrier dysfunction links metabolic and inflammatory markers of aging to death in Drosophila. Proceedings of the National Academy of Sciences of the United States of America. 2012; 109(52):21528-21533.
" # . 4 5 M N o p ! " 6 7 8 B =
O
W p c
d
R T V f h p r úöîîãööööÙî h?A 5 h?A H*h?A 5nHo(tH h?A nHtH h?A h> nHo(tHh?A nHo(tHh0 nHtH h0 6h0 h0 h?A 5nHtHh0 h0 5nHtHh?A mH nHo(u < # 7 8 B
W X p r $ " " " ( ( d ` d `gd0 d 7$8$H$ " $ N Z j | [ b
8 ƾƘ} h mH nH tHu j h UmH nH tHu h 9; mH nH tHu j h 9; UnHtHj h 9; UnHtHh 9; nHtH j h?A UnHtH h?A o(h?A h?A mH nHu h?A mH nHo(u h?A nHo(tHh?A nHtH*8 9 : ; < = > ? S ^ f g ! ! #" " " 8# 9# :# I# J# ^# _# a# ǻҏǻ|ppap j h 9; UnHtHj h 9; UnHtHhS0 nHtH h?A 5\nHtH $ju h UmH nH tHu h 9; nHtH h?A nHtH h?A nHo(tHj h?A UnHtHh 9; mH nH tHuh mH nH tHu j h UmH nH tHu $j h UmH nH tHu&a# b# c# # # # # # # # # % ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ( ( ( ( ( ( ( !( /( e( ( ththt` hS: nHtH h?A 5\nHo(tHh?A 5\nHtH $j{ h UmH nH tHu jk h 9; UnHtHh 9; nHtH h?A nHo(tHh?A nHtH j h 9; UnHtH$j h UmH nH tHu h mH nH tHu j h UmH nH tHu h 9; mH nH tHu %( /( . . . 2 2 2 K4 L4 S4 4 4 4 6 6 7 v8 w8 8 1: 2: <: Q< R< d< d ` 7$8$H$
d 7$ 8$ H$ ` d ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ) ) &) 3) A) F) ) )
, , , , . . . . . . . . . . . / vm h?A mH nHu h?A mH nHo(u h?A H*nHtHh?A nHo(tHh?A nHtH hS: nHtH $j& h UmH nH tHu h mH nH tHu j h UmH nH tHu h 9; mH nH tHu j h 9; UnHtHh 9; nHtH j h 9; UnHtH (/ / / / / E/ F/ G/ H/ I/ J/ K/ M/ m/ v/ / / / / 0 0 0 0 0 0 0 0 1 1 1 1 1 2 2 2 #2 %2 G2 \2 2 2 2 2 2 2 2 2 ɾɾ䣛 h?A 5\nHtH h?A h?A nHo(tHh?A nHtH hS: nHtH $j=1 h UmH nH tHu h mH nH tHu j h UmH nH tHu h 9; mH nH tHuj h 9; UnHtH jO' h 9; UnHtH .2 2 2 2 2 "3 #3 23 33 G3 H3 J3 K3 L3 z3 {3 |3 }3 ~3 3 3 3 3 3 K4 L4 R4 S4 g4 4 4 6 6 6 6 6 6 ̽Բ{{rg{g{_ h|R nHtH h?A mH nHo(u h?A mH nHu h?A nHo(tH$j: h UmH nH tHu h mH nH tHu j h UmH nH tHu h 9; mH nH tHu j1 h 9; UnHtHh 9; nHtH j h 9; UnHtHh?A nHtH h?A 5\nHtH h?A 5\nHo(tH $6 6 6 6 6 6 6 6 6 6 6 6 6 7 8 8 v8 w8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 %9 ɾɾ䢗xxppaɾ jE h 9; UnHtHh 9; nHtH h?A 5\nHo(tHh?A 5\nHtH h?A nHtH h?A mH nHo(u h?A nHo(tH$j!E h UmH nH tHu h mH nH tHu j h UmH nH tHu h 9; mH nH tHuj h 9; UnHtH j3; h 9; UnHtH !%9 &9 '9 (9 )9 *9 +9 -9 9 9 : : : : ): 0: 2: 3: <: h: i: : : : ; W; ]; j; ; ; ; ; R< d< < < < < < < < < ǻuj h?A mH nHo(u h?A 6H*]nHo(tH h?A 6]nHo(tHh?A 5\nHtH h?A 5\nHo(tHh?A h?A nHo(tHh?A nHtH j h 9; UnHtHh 9; mH nH tHuh mH nH tHu j h UmH nH tHu $jN h UmH nH tHu)< < < 5= 6= g= h= l= w= = = = = = = -> .> /> 5> l> m> z> {> > > > > > > > > > > ? ? ? ? *? +? -? .? /? a? b? c? d? e? f? g? ƾƾƤ $jW h UmH nH tHu j h UmH nH tHu h mH nH tHu j O h UnHtHh nHtH j h UnHtHh?A mH nHo(u h?A mH nHu h?A nHtH h?A H*h?A nHo(tHh?A 0d< > > > G G G 4Q 5Q NQ -a .a 9a >b b c Ѕ gd 7$8$H$ d d ` g? h? ? ? C@ E@ @ @ @ 7G 8G 9G :G mG nG oG pG qG rG sG tG G G G G NH OH I J J P P P ӕvrjfj] h mH nH uh j h Uh?A j ah?A nHtH h?A mH nHo(u h?A mH nHu h#? nHtH $jX h UmH nH tHu j h UmH nH tHu h mH nH tHuh nHtH j h UnHtHh% nHtH h?A nHo(tHh?A nHtH hm^ nHtH P P ,Q -Q .Q /Q 0Q 1Q 2Q 3Q 4Q NQ Q Q X X X X !Y "Y #Y $Y %Y &Y 'Y Z %Z &Z ` ` ` ` ` ` ` ` ` ` ` ` -a .a 8a 9a пȪпЪȑy hm^ h 9; 5nHtHhm^ hm^ 5nHtHh 9; nHtH jsY h UmH nH u h$ j Y h UmH nH u h h?A 5h?A h~ j h U jX h UmH nH u h mH nH uj h UmH nH u+9a :a La Ma c h?A nHo(tHUh mH nH tHuh 9; nHtH j h 9; UnHtH 4. Rera M, Bahadorani S, Cho J, Koehler CL, Ulgherait M, Hur JH, Ansari WS, Lo T, Jr., Jones DL and Walker DW. Modulation of longevity and tissue homeostasis by the Drosophila PGC-1 homolog. Cell metabolism. 2011; 14(5):623-634.
5. Bahadorani S, Cho J, Lo T, Contreras H, Lawal HO, Krantz DE, Bradley TJ and Walker DW. Neuronal expression of a single-subunit yeast NADH-ubiquinone oxidoreductase (Ndi1) extends Drosophila lifespan. Aging cell. 2010; 9(2):191-202.
6. Cognigni P, Bailey AP and Miguel-Aliaga I. Enteric neurons and systemic signals couple nutritional and reproductive status with intestinal homeostasis. Cell metabolism. 2011; 13(1):92-104.
7. Schneider CA, Rasband WS and Eliceiri KW. NIH Image to ImageJ: 25 years of image analysis. Nature methods. 2012; 9(7):671-675.
8. Geminard C, Rulifson EJ and Leopold P. Remote control of insulin secretion by fat cells in Drosophila. Cell metabolism. 2009; 10(3):199-207.
, 1h / =!"#$% D Ja20075050[1]5050505017Ja, W. W.Carvalho, G. B.Mak, E. M.de la Rosa, N. N.Fang, A. Y.Liong, J. C.Brummel, T.Benzer, S.Division of Biology 156-29, California Institute of Technology, Pasadena, CA 91125, USA.Prandiology of Drosophila and the CAFE assayProc Natl Acad Sci U S AProceedings of the National Academy of Sciences of the United States of AmericaProc Natl Acad Sci U S AProceedings of the National Academy of Sciences of the United States of AmericaProc Natl Acad Sci U S AProceedings of the National Academy of Sciences of the United States of America8253-6104202007/05/15Animals*Biological AssayDrosophila melanogaster/drug effects/*physiologyEthanol/pharmacologyFeeding Behavior/drug effects/*physiologyParaquat/pharmacologyTime Factors2007May 150027-8424 (Print)
0027-8424 (Linking)17494737Research Support, N.I.H., Extramural
Research Support, Non-U.S. Gov't
Research Support, U.S. Gov't, Non-P.H.S.http://www.ncbi.nlm.nih.gov/pubmed/17494737189910910.1073/pnas.0702726104eng s D y K _ E N R E F _ 1 s D y K _ E N R E F _ 2 D Rera2012533[3]53353317Rera, M.Clark, R. I.Walker, D. W.Department of Integrative Biology and Physiology, University of California, Los Angeles, CA 90095, USA.Intestinal barrier dysfunction links metabolic and inflammatory markers of aging to death in DrosophilaProc Natl Acad Sci U S AProceedings of the National Academy of Sciences of the United States of AmericaProc Natl Acad Sci U S AProceedings of the National Academy of Sciences of the United States of AmericaProc Natl Acad Sci U S AProceedings of the National Academy of Sciences of the United States of America21528-3310952Aging/*metabolism/*pathologyAnimalsAntimicrobial Cationic Peptides/metabolismBiological Markers/metabolismDrosophila Proteins/metabolismDrosophila melanogaster/*metabolismFemaleGreen Fluorescent Proteins/metabolismInflammation/*metabolismInsulin/metabolismIntestines/*metabolism/*physiopathologyMitochondria/metabolismSignal Transduction2012Dec 261091-6490 (Electronic)
0027-8424 (Linking)23236133http://www.ncbi.nlm.nih.gov/pubmed/23236133353564710.1073/pnas.1215849110 s D y K _ E N R E F _ 3 D Rera2012533[3]53353317Rera, M.Clark, R. I.Walker, D. W.Department of Integrative Biology and Physiology, University of California, Los Angeles, CA 90095, USA.Intestinal barrier dysfunction links metabolic and inflammatory markers of aging to death in DrosophilaProc Natl Acad Sci U S AProceedings of the National Academy of Sciences of the United States of AmericaProc Natl Acad Sci U S AProceedings of the National Academy of Sciences of the United States of AmericaProc Natl Acad Sci U S AProceedings of the National Academy of Sciences of the United States of America21528-3310952Aging/*metabolism/*pathologyAnimalsAntimicrobial Cationic Peptides/metabolismBiological Markers/metabolismDrosophila Proteins/metabolismDrosophila melanogaster/*metabolismFemaleGreen Fluorescent Proteins/metabolismInflammation/*metabolismInsulin/metabolismIntestines/*metabolism/*physiopathologyMitochondria/metabolismSignal Transduction2012Dec 261091-6490 (Electronic)
0027-8424 (Linking)23236133http://www.ncbi.nlm.nih.gov/pubmed/23236133353564710.1073/pnas.1215849110 s D y K _ E N R E F _ 3 D Rera2011801[4]80180117Rera, M.Bahadorani, S.Cho, J.Koehler, C. L.Ulgherait, M.Hur, J. H.Ansari, W. S.Lo, T., Jr.Jones, D. L.Walker, D. W.Department of Integrative Biology and Physiology, University of California-Los Angeles, CA 90095, USA.Modulation of longevity and tissue homeostasis by the Drosophila PGC-1 homologCell MetabCell metabolismCell MetabCell metabolismCell MetabCell metabolism623-34145AnimalsCell RespirationDrosophila Proteins/genetics/*metabolismDrosophila melanogaster/genetics/*metabolismEnergy Metabolism/physiologyFemaleGene Expression/physiologyGlucose/metabolismHomeostasis/physiologyIntestines/cytology/*metabolismLongevity/*geneticsMaleMammalsMiceMitochondria/genetics/*metabolismOrgan SpecificityPositive Transcriptional Elongation Factor B/genetics/*metabolismSequence Homology, Amino AcidStem Cells/cytology/metabolismTranscription Factors/genetics/*metabolism2011Nov 21932-7420 (Electronic)
1550-4131 (Linking)22055505http://www.ncbi.nlm.nih.gov/pubmed/22055505323879210.1016/j.cmet.2011.09.013s D y K _ E N R E F _ 4 D Rera2011801[4]80180117Rera, M.Bahadorani, S.Cho, J.Koehler, C. L.Ulgherait, M.Hur, J. H.Ansari, W. S.Lo, T., Jr.Jones, D. L.Walker, D. W.Department of Integrative Biology and Physiology, University of California-Los Angeles, CA 90095, USA.Modulation of longevity and tissue homeostasis by the Drosophila PGC-1 homologCell MetabCell metabolismCell MetabCell metabolismCell MetabCell metabolism623-34145AnimalsCell RespirationDrosophila Proteins/genetics/*metabolismDrosophila melanogaster/genetics/*metabolismEnergy Metabolism/physiologyFemaleGene Expression/physiologyGlucose/metabolismHomeostasis/physiologyIntestines/cytology/*metabolismLongevity/*geneticsMaleMammalsMiceMitochondria/genetics/*metabolismOrgan SpecificityPositive Transcriptional Elongation Factor B/genetics/*metabolismSequence Homology, Amino AcidStem Cells/cytology/metabolismTranscription Factors/genetics/*metabolism2011Nov 21932-7420 (Electronic)
1550-4131 (Linking)22055505http://www.ncbi.nlm.nih.gov/pubmed/22055505323879210.1016/j.cmet.2011.09.013s D y K _ E N R E F _ 4 D Rera2012632[3]63263217Rera, M.Clark, R. I.Walker, D. W.Department of Integrative Biology and Physiology, University of California, Los Angeles, CA 90095, USA.Intestinal barrier dysfunction links metabolic and inflammatory markers of aging to death in DrosophilaProc Natl Acad Sci U S AProceedings of the National Academy of Sciences of the United States of AmericaProc Natl Acad Sci U S AProceedings of the National Academy of Sciences of the United States of AmericaProc Natl Acad Sci U S AProceedings of the National Academy of Sciences of the United States of America21528-3310952Aging/*metabolism/*pathologyAnimalsAntimicrobial Cationic Peptides/metabolismBiological Markers/metabolismDrosophila Proteins/metabolismDrosophila melanogaster/*metabolismFemaleGreen Fluorescent Proteins/metabolismInflammation/*metabolismInsulin/metabolismIntestines/*metabolism/*physiopathologyMitochondria/metabolismSignal Transduction2012Dec 261091-6490 (Electronic)
0027-8424 (Linking)23236133http://www.ncbi.nlm.nih.gov/pubmed/23236133353564710.1073/pnas.1215849110 s D y K _ E N R E F _ 3 D Rera2011801[4]80180117Rera, M.Bahadorani, S.Cho, J.Koehler, C. L.Ulgherait, M.Hur, J. H.Ansari, W. S.Lo, T., Jr.Jones, D. L.Walker, D. W.Department of Integrative Biology and Physiology, University of California-Los Angeles, CA 90095, USA.Modulation of longevity and tissue homeostasis by the Drosophila PGC-1 homologCell MetabCell metabolismCell MetabCell metabolismCell MetabCell metabolism623-34145AnimalsCell RespirationDrosophila Proteins/genetics/*metabolismDrosophila melanogaster/genetics/*metabolismEnergy Metabolism/physiologyFemaleGene Expression/physiologyGlucose/metabolismHomeostasis/physiologyIntestines/cytology/*metabolismLongevity/*geneticsMaleMammalsMiceMitochondria/genetics/*metabolismOrgan SpecificityPositive Transcriptional Elongation Factor B/genetics/*metabolismSequence Homology, Amino AcidStem Cells/cytology/metabolismTranscription Factors/genetics/*metabolism2011Nov 21932-7420 (Electronic)
1550-4131 (Linking)22055505http://www.ncbi.nlm.nih.gov/pubmed/22055505323879210.1016/j.cmet.2011.09.013s D y K _ E N R E F _ 4 D Bahadorani2010805[5]80580517Bahadorani, S.Cho, J.Lo, T.Contreras, H.Lawal, H. O.Krantz, D. E.Bradley, T. J.Walker, D. W.Department of Physiological Science, University of California, Los Angeles, Los Angeles, CA 90095-1527, USA.Neuronal expression of a single-subunit yeast NADH-ubiquinone oxidoreductase (Ndi1) extends Drosophila lifespanAging CellAging cellAging CellAging cellAging CellAging cell191-20292AnimalsCell Cycle Proteins/genetics/*metabolismCell RespirationCell SurvivalDrosophila melanogaster/enzymology/genetics/*physiologyFemaleFertilityLongevityMaleMitochondria/metabolismNeurons/cytology/drug effects/*metabolismOrgan SpecificityOxidative StressRotenone/toxicitySaccharomyces cerevisiae/genetics/*metabolismSaccharomyces cerevisiae Proteins/genetics/*metabolism2010Apr1474-9726 (Electronic)
1474-9718 (Linking)20089120http://www.ncbi.nlm.nih.gov/pubmed/20089120286000210.1111/j.1474-9726.2010.00546.x s D y K _ E N R E F _ 5 D Cognigni2011861[6]86186117Cognigni, P.Bailey, A. P.Miguel-Aliaga, I.Department of Zoology, University of Cambridge, Downing Street, Cambridge CB2 3EJ, UK.Enteric neurons and systemic signals couple nutritional and reproductive status with intestinal homeostasisCell MetabCell metabolismCell MetabCell metabolismCell MetabCell metabolism92-104131Acid-Base EquilibriumAnimalsAppetite Regulation/physiologyDietDiuresisDrosophila/metabolism/physiologyEnteric Nervous System/*physiologyFemaleGastrointestinal Tract/*innervation/metabolism/physiologyGastrointestinal TransitHemostaticsMaleNeurons, Efferent/*physiologyReproductionSensory Receptor Cells/*physiologySex Attractants/physiologyVasopressins/physiology2011Jan 51932-7420 (Electronic)
1550-4131 (Linking)21195352http://www.ncbi.nlm.nih.gov/pubmed/21195352303826710.1016/j.cmet.2010.12.010s D y K _ E N R E F _ 6 s D y K _ E N R E F _ 7 s D y K _ E N R E F _ 7 s D y K _ E N R E F _ 8 s D y K _ E N R E F _ 7 6 6 6 6 6 6 6 6 6 v v v v v v v v v 6 6 6 6 6 6 > 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 h H 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 2 0 @ P ` p 2 ( 0 @ P ` p 0 @ P ` p 0 @ P ` p 0 @ P ` p 0 @ P ` p 0 @ P ` p 8 X V ~ PJ _HmH nH sH tH @ ` @ N o r m a l CJ _HaJ mH sH tH ^ @ ^ H e a d i n g 3 $d 7$ 8$ @&H$ 5PJ \mH nH tHu V @ B V H e a d i n g 4 d d @&[$\$ 5OJ PJ QJ \^J D A D D e f a u l t P a r a g r a p h F o n t Z i@ Z T a b l e N o r m a l :V 4
l 4 a _H ( k ( N o L i s t 6 U` 6 H y p e r l i n k >*B*ph R ^@ R N o r m a l ( W e b ) d d [$\$ OJ PJ QJ ^J PK ! pO [Content_Types].xmlj0Eжr(] yl#!MB ;.n̨̽\ A1&ҫ
QWKvUbOX#&1`RT9<l#$>r `С-;c=1g~'}xPiB$I O1Êk9IcLHY<;*v7'aE\h >=^,*8q;^*4?Wq{ nԉogAߤ>8f2*<")QHxK
|]Zz)ӁMSm@\&>!7;wP3[EBU`1OC5VD
Xa?p
S4[NS28;Y[,T1|n;+/ʕj\\ ,E:!
t4.T̡ e1
}; [z^pl@ok0e
g@GGHPXNT,مde|*YdT\Y䀰+(T7$ow2缂#G֛ʥ?q NK-/M,WgxFV /FQⷶO&ecx\QLW@H ! +{[|{!KAi
`cm2iU|Y+ ި [[vxrNE3pmR
=Y04,!&0+WC ܃@oOS2'Sٮ05$ɤ]pm3Ft GɄ-!y"ӉV
.
`עv,O.%вKasS ƭvMz`3{9+e@eՔLy7W_Xtl PK !
ѐ ' theme/theme/_rels/themeManager.xml.relsM
0wooӺ&݈Э5
6?$Q
,.aic21h:qm@RN;d`o7gK(M&$R(.1r'JЊT8V"AȻHu}|$b{ P8g/ ]QAsم(#L[ PK- ! pO [Content_Types].xmlPK- ! ֧ 6 - _rels/.relsPK- ! ky theme/theme/themeManager.xmlPK- ! !Z! theme/theme/theme1.xmlPK- !
ѐ ' (
theme/theme/_rels/themeManager.xml.relsPK ] #
MZ 8 a# ( / 2 6 %9 < g? P 9a 2 4 5 6 8 9 : ; < = ? @ A ( d< 3 7 >
1 3 5 1 A W X Z } " " # # # ># @# B# & *& @& A& C& s& u& w& ) ) ) ) ) ) ) ) + + + + + , , ", 1
2 #2 $2 &2 Z2 \2 ^2 3 /: 1: f: h: j: y= C C %D 'D )D D K K L L L M S S S S S 1T DT KZ MZ QQ@X̕QX̕QQ@X̕QQ@X̕QQ@X̕QQ@X̕QQ@X̕QQ@X̕QQ@X̕QQ@X̕QX̕QX̕QX̕QX̕Q _ E N R E F _ 1 _ E N R E F _ 2 _ E N R E F _ 3 _ E N R E F _ 4 _ E N R E F _ 5 _ E N R E F _ 6 _ E N R E F _ 7 _ E N R E F _ 8 ET 6U U V W xX 8Y Y OZ 5U U V W wX 7Y Y IZ OZ 6 8 E G H L \ ^ ! L W
+ y . 0 [
e
y
0 5 E I \ e f o } A K v D N P Z \ d f i L S P W ; A U W ! ! 8" >" B" J" " " ' ' ' ' ' ' ( (( ( ( ( ( ) #) 4) 8) w) }) * * * * a, l, l. s. / / / / 2 2 3 3 : : : : :; A; ; ; < < = = r= x= YL \L L L M M OZ 7 9 < A " * ( (( _1 i1 OZ : : : : : : : : : : : : ~ S: 9; #? ?A m^ 0 $ % |R 8 S0 > MZ OZ E N . I n s t a n t F o r m a t E N . L a y o u t E N . L i b r a r i e s < E N I n s t a n t F o r m a t > < E n a b l e d > 0 < / E n a b l e d > < S c a n U n f o r m a t t e d > 0 < / S c a n U n f o r m a t t e d > < S c a n C h a n g e s > 0 < / S c a n C h a n g e s > < S u s p e n d e d > 0 < / S u s p e n d e d > < / E N I n s t a n t F o r m a t > < E N L a y o u t > < S t y l e > A g i n g < / S t y l e > < L e f t D e l i m > { < / L e f t D e l i m > < R i g h t D e l i m > } < / R i g h t D e l i m > < F o n t N a m e > T i m e s N e w R o m a n < / F o n t N a m e > < F o n t S i z e > 1 2 < / F o n t S i z e > < R e f l i s t T i t l e > < / R e f l i s t T i t l e > < S t a r t i n g R e f n u m > 1 < / S t a r t i n g R e f n u m > < F i r s t L i n e I n d e n t > 0 < / F i r s t L i n e I n d e n t > < H a n g i n g I n d e n t > 7 2 0 < / H a n g i n g I n d e n t > < L i n e S p a c i n g > 0 < / L i n e S p a c i n g > < S p a c e A f t e r > 0 < / S p a c e A f t e r > < H y p e r l i n k s E n a b l e d > 1 < / H y p e r l i n k s E n a b l e d > < H y p e r l i n k s V i s i b l e > 0 < / H y p e r l i n k s V i s i b l e > < / E N L a y o u t > < L i b r a r i e s > < i t e m d b - i d = " r s t s f f 9 2 k 2 v e 2 1 e 5 z x q x p z z 4 f s v x r 9 v 9 a f t f " > M y E n d N o t e L i b r a r y < r e c o r d - i d s > < i t e m > 5 3 3 < / i t e m > < i t e m > 6 3 2 < / i t e m > < i t e m > 8 0 1 < / i t e m > < i t e m > 8 0 5 < / i t e m > < i t e m > 8 6 1 < / i t e m > < i t e m > 8 6 2 < / i t e m > < i t e m > 8 6 3 < / i t e m > < / r e c o r d - i d s > < / i t e m > < / L i b r a r i e s > @ A A S}4 4 A A | ! # $ V MZ @ @ ( @ * \ @ 0 d @ @ U n k n o w n G * Ax T i m e s N e w R o m a n 5 S y m b o l 3 * Cx A r i a l ; |i0 B a t a n g I ? ? A r i a l U n i c o d e M S A $ B C a m b r i a M a t h " q h rGG z
L . z
L . ! 24 Z Z # 3q P $P 2 ! x x , " S u p p l e m e n t a l M a t e r i a l s a n d M e t h o d s U s e r D a v i d W a l k e r
Oh +'0 $ 0
T `
l x ' $ Supplemental Materials and Methods User Normal.dotm David Walker 3 Microsoft Macintosh Word @ @ ʠŨ@ 8`ʨ z
L
՜. +,D ՜. +,\ h p
' Organization . Z # Supplemental Materials and Methods Title < 8 @ _PID_HLINKS ' A T F b _ E N R E F _ 7 I \ _ E N R E F _ 8 F V _ E N R E F _ 7 F P _ E N R E F _ 7 G J _ E N R E F _ 6 D B _ E N R E F _ 5 E : _ E N R E F _ 4 B 2 _ E N R E F _ 3 E * _ E N R E F _ 4 E " _ E N R E F _ 4 B _ E N R E F _ 3 B _ E N R E F _ 3 C
_ E N R E F _ 2 @ _ E N R E F _ 1
! " # $ % & ' ( ) * + , - . / 0 1 2 3 4 5 6 7 8 9 : ; < = > ? @ A B C D F G H I J K L M N O P Q R S T U V W X Y Z [ \ ] ^ _ ` a b c d e f g h i j k l m n o p q s t u v w x y z { | } ~ R o o t E n t r y F ʨ D a t a
E Y 1 T a b l e r ) W o r d D o c u m e n t . S u m m a r y I n f o r m a t i o n ( D o c u m e n t S u m m a r y I n f o r m a t i o n 8 C o m p O b j ` F Microsoft Word 97-2004 Document NB6W Word.Document.8