Inducing cellular senescence in vitro by using genetically encoded photosensitizers

Overview of the approach

Recently, we reported a novel mechanism of cellular senescence induction by mild genotoxic stress [30,31]. Specifically, we showed that formation of a small number of DNA lesions in normal and cancer cells during S phase leads to cellular senescence-like arrest within the same cell cycle. The mechanism of this arrest includes DNA strand breaking in S-phase cells, the collision of replication forks with the breaks, and the formation of difficult-to-repair DSBs [30]. Subsequently, persistent DDR results in proliferation arrest with a cellular senescence phenotype (Figure 1A). This mechanism is noteworthy because it utilizes extremely low concentrations of DNA-damaging agents (e.g., nanomolar concentrations of camptothecin was applied to the cells for 30-60 minutes) to induce cellular senescence [30]. Based on this mechanism, we developed an approach to remotely induce premature senescence in human cell cultures using short-term light irradiation. We employed the genetically encoded photosensitizers tKR and miniSOG and targeted them to chromatin to induce DNA lesions, which, in turn, induced difficult-to-repair DSBs, persistent DDR, and, subsequently, the development of the cellular senescence phenotype (Figure 1B). Briefly, the procedure used to induce cellular senescence includes the following steps: i) establishment of the cell line that transiently or stably expresses either tKR or miniSOG fused to core histone H2B to direct them to chromatin, ii) synchronization of the cells in S phase, and iii) light illumination of the cells (Figure 1B). In the current study, we generally used human HeLa Kyoto cell lines that stably express H2B-tKR or H2B-miniSOG, which were previously established by lentiviral transduction with corresponding constructs [17,32]. We should mention that the expression levels of H2B-tKR (in contrast to H2B-miniSOG) fusion protein vary significantly across the population of stably transfected cells. This follows from a high cellular heterogeneity of H2B-tKR fusion protein fluorescence (data not shown). This observation is in agreement with the results of quantitative RT-PCR showing that the expression of H2B-miniSOG in the HeLa Kyoto cell line, which stably expresses this fusion protein, is approximately sevenfold higher than the expression of H2B-tKR in the corresponding cell line (data not shown). It was shown earlier that the fusion of tKR or miniSOG to core histone H2B effectively targets them to chromatin but does not induce cell killing or cell cycle alterations until the cells are illuminated with a specific wavelength of light [17,19]. To synchronize the cells in S phase, we performed a double thymidine block, although one can use any other synchronization technique. Moreover, an asynchronous cell population can also be used; in this case, only the S-phase cells will senesce. To activate H2B-miniSOG or H2B-tKR, we illuminated the corresponding cell lines with blue light (465/95 nm, 65 mW/cm²) for 5 minutes or with green light (540/80 nm, 200 mW/cm²) for 15 minutes, respectively. As it will be shown below such illumination conditions were sufficient to induce cellular senescence but did not lead to cell killing.

DNA damage induced by miniSOG and tKR

First, we analyzed whether genetically encoded photosensitizers targeted to chromatin could induce DNA strand breaks. Photosensitizers produce different ROS upon light-induced activation: O₂¯, hydrogen peroxides and hydroxyl radicals by the Type I photosensitization reaction and ¹O₂ by the Type II reaction. It is generally thought that these ROS can induce DNA damage. Indeed, it is quite well defined that hydrogen peroxide (H₂O₂) and hydroxyl (¯OH) stimulate DNA strand breaks, along with base and sugar oxidation [33]. It is much more complicated to determine the DNA-damaging effects of O₂¯ and ¹O₂. Although O₂¯ does not interact with undamaged DNA, it was shown that it could react with oxidatively generated DNA base radicals [34,35]. Furthermore, O₂¯ can give rise to H₂O₂ and ¯OH radicals via a two-stage reaction [28]. ¹O₂ specifically reacts with guanines, thus producing 8-oxoguanines in DNA; however, the question of whether ¹O₂ can induce DNA strand breaks is still open [36,37]. It should also be mentioned that the DNA-damaging effects of O₂¯ and ¹O₂ have been studied in vitro using free DNA in aqueous solutions. Therefore, it is questionable whether these ROS react with chromatin in living cells in a similar fashion. It is unclear what type of DNA damage can be induced by the genetically encoded photosensitizers, such as miniSOG and tKR. It had been only reported that the chromatin-targeted tKR could oxidize DNA bases [17,27]. It is established that light-illumination of miniSOG leads to ¹O₂ production [19,26], but the activation of tKR predominantly results in the formation of O₂¯; however, the possibility that tKR also produces ¹O₂ was not fully excluded [24,25,38]. Here, we investigated whether the chromatin-targeted miniSOG and tKR could induce DNA strand breaks upon activation by light illumination. For this purpose, we used the single-cell gel electrophoresis (SCGE) technique, also known as the “comet assay” [39]. The tail moment, the most meaningful parameter of the comet, which represents the tail length multiplied by the fraction of DNA in the tail, was chosen as a criterion for the degree of DNA breakage.

First, we analyzed SSB generation in asynchronous HeLa cells expressing either H2B-miniSOG or H2B-tKR that were illuminated with the corresponding light source. We used an alkaline modification of the comet assay to perform this analysis. As a positive control for the presence of SSB, we used H₂O₂-treated cells. Blue- or green-light irradiation by itself did not induce any detectable DNA damage in control cells (Figure 2A). However, both chromatin-targeted miniSOG and tKR induced a significant number of SSBs (Figure 2A). As expected, miniSOG known to produce ¹O₂ [19,26], had a much more pronounced DNA-damaging effect than tKR; it was comparable to the effects of high concentrations of H₂O₂ (200 μM, 1 h). However, this may also be due to several-fold higher level of expression of H2B-miniSOG fusion relative to H2B-tKR fusion (data not shown). It is interesting that although a significant portion of the SSBs induced by miniSOG were repaired within 30 minutes after illumination (Figure 2A, “BL+rec”), the tKR-induced lesions remained unresolved at this time point (Figure 2A, “GL+rec”). The mechanism of tKR-dependent SSB formation is elusive; the only possible (known) way for O₂¯ to induce DNA strand breaks is to be converted into H₂O₂ and ¯OH in a two-step reaction utilizing superoxide dismutase (SOD) and active metal ions [28]. However, the presence of SOD in the nuclei of the untreated cells is controversial – it was recently shown that Sod1 was only translocated from the cytoplasm to the nucleus only upon oxidative stress (treatment of cells with H₂O₂) [40]. It may be that tKR still generates a number of ¹O₂ that is responsible for SSB generation in this case.

We next analyzed DSB generation in asynchronous HeLa cells expressing either H2B-miniSOG or H2B-tKR. For this purpose, we used the neutral comet assay; as a positive control for the presence of DSBs, we used cells that had been treated with the topoisomerase II poison etoposide (VP16; 10 µg/ml, 1 hr). Similar to SSBs, DSBs were not induced in response to illumination in HeLa cells that did not express the photosensitizers (Figure 2B). DSBs were only generated in HeLa cells expressing H2B-miniSOG that were illuminated with blue light (Figure 2B). Collectively, these results suggest that although both chromatin-targeted photosensitizers effectively stimulate SSB formation upon light irradiation, miniSOG can also produce DSBs.

Light-induced cellular senescence

Cellular senescence may be recognized by the manifestation of several typical signs, including cell and nuclear enlargement, senescence-associated β-galactosidase activity (SA-β-gal), the formation of senescence-associated heterochromatin foci (SAHF) and persistent DDR foci, senescence-associated secretory phenotype (SASP), increased expression of cyclin-dependent kinase inhibitors, etc [41,42]. The composition of these markers in a particular cellular senescence state greatly depends on the cell type and on the senescence-inducing stimulus. To test whether light irradiation of the chromatin-targeted photosensitizers induces cellular senescence, we first investigated DDR focus formation. For this purpose, the “parent” HeLa Kyoto cell line and its derivatives that stably express H2B-miniSOG or H2B-tKR were synchronized in S phase, light irradiated (465/95 and 540/80 nm), incubated for 48 hours, and immunostained with an antibody against γH2AX (phosphorylated at serine-139 variant histone H2AX), which is an ubiquitous DDR marker [43,44]. It is evident that extensive DDR foci formation was only observed in the photosensitizer-expressing HeLa cells that had been illuminated with the relevant light (blue or green) (Figure 3A and 4A). It should be highlighted that γH2AX foci were not formed in the non-irradiated cells or in cells that were illuminated with an inappropriate light (blue light for tKR, and green light for miniSOG). This apparently means that the light-irradiation conditions (wavelength, power, and time) are not toxic to the cells by themselves. It is also worth noting that the cells exhibiting extensive γH2AX staining possessed enlarged nuclei, which is another senescence biomarker (Figure 3D).

To ascertain that the light irradiation-induced state does represent cellular senescence, we assayed the cells that were treated as described above for SA-β-gal activity, the most universal feature of cellular senescence [45]. As expected, only HeLa cells that expressed the photosensitizers and were irradiated with the appropriate light exhibited increased SA-β-gal activity (Figure 3B-C and 4B).

To investigate the temporal kinetics of cellular senescence we assessed the presence of γH2AX foci in HeLa cells expressing either H2B-miniSOG or H2B-tKR that were light irradiated and recovered for different time periods (0, 3, 6 and 24 hours) (Figure 5A-B). We found that γH2AX foci were formed during the first hours, but not immediately after light-illumination, and did not disappear, thus, forming persistent DDR foci (Figure 5A-B). Western blot analysis of γH2AX fully confirmed the results obtained using indirect immunofluorescence (Figure 5A-B). Together, these observations support our model of delayed replication-dependent induction of difficult-to-repair DSBs [30].

It is well known that the senescence state is maintained by either p16^INK4A- or p21^CIP1-dependent signaling pathways [41]. In DNA damage-induced cellular senescence, the expression of p21^CIP1 is usually increased. Using quantitative reverse transcription-PCR (qRT-PCR) and western blotting, we found that p21^CIP1 but not p16^INK4A was upregulated in response to light irradiation of HeLa cells that express either H2B-miniSOG or H2B-tKR (Figure 6A-B). Interestingly, p21^CIP1 expression was upregulated only after a protracted recovery period (24 h) and not immediately after illumination (Figure 6A-B).

Finally, we decided to test whether the approach proposed is effectively compatible with a transient expression of these genetically encoded photosensitizers. For this purpose, we analyzed the induction of cellular senescence in HeLa cells that were transiently transfected with either H2B-miniSOG or H2B-tKR constructs, and then illuminated with an appropriate light. The results obtained clearly show that one can use transient transfection with genetically encoded photosensitizers to induce cellular senescence (Supplementary Figure 1).

In summary, we conclude that the HeLa cells that express H2B-fused photosensitizers acquire a senescence phenotype upon illumination with the appropriate light source in early S phase. This phenotype is characterized by nuclear enlargement, the appearance of DDR foci, increased SA-β-gal activity, and the expression of the CDK inhibitor p21^CIP1 (Figures 3 and 4). Interestingly, premature senescence was induced much more effectively in HeLa cells that expressed H2B-miniSOG. This is apparent from the fact that, in contrast to the H2B-miniSOG-expressing HeLa cells, not all of the H2B-tKR-expressing cells senesce in response to light illumination (Figure 2A and B). This difference may reflect the higher level of H2B-miniSOG expression and increased efficiency of miniSOG in inducing ROS production.

Cell culture, synchronization and transfection

HeLa cell line and HeLa Kyoto cell lines that stably express either H2B-tKR or H2B-miniSOG and their non-expressing counterparts were used. The cells were cultured in DMEM (PanEco) supplemented with 10% fetal bovine serum (FBS; HyClone/GE Healthcare), 10 U/ml penicillin (PanEco) and 10 μg/ml streptomycin (PanEco). The cells were grown at 37°C and 5% CO₂ in a conventional humidified CO₂ incubator. For synchronization by double-thymidine block, 30% confluent cells were incubated with 2 mM thymidine for 16 h, released from the block for 9 h, and then incubated with thymidine for an additional 16 h. To release the cells from thymidine, they were washed twice with phosphate-buffered saline (PBS) and incubated in fresh culture medium.

HeLa cells were transfected with 2 µg of either H2B-miniSOG or H2B-tKR construct using Xfect transfection reagent (Clontech) following the manufacturer’s instructions. After 24 h, cells were illuminated to induce cellular senescence. The efficiency of transfection was estimated by fluorescence of genetically encoded photosensitizers transfected; usually more than 80% of cells were transfected.

Cell illumination

An inverted Nikon Eclipse Ti-E fluorescence microscope equipped with a Nikon Intensilight C-HGFI light source and a Nikon Plan Fluor 4x/0.13 objective was used to illuminate the cells. A standard filter set was used to acquire the relevant fluorescence signals and to illuminate the cells. The FITC filter set was used for blue-light illumination (excitation band pass (BP) 465/95 nm, emission BP 515/55 nm), and the Tx Red filter set was used for green-light illumination (excitation BP 540/80 nm, emission BP 600/60 nm). A Laser Power Meter LP1 (Sanwa) was used to measure the total power of the excitation light. The light power density (W/cm²) was estimated by dividing the total power by the area of the illuminated region. The cells stably expressing H2B-miniSOG were illuminated for 5 min with blue light (65 mW/cm² light power density), and the H2B-tKR expressing cells were illuminated for 15 min with green light (200 mW/cm² light power density).

Indirect immunofluorescence

Cells were grown on microscope slides, illuminated, fixed, and permeabilized in CSK buffer (10 mM PIPES, pH 7.0, 100 mM NaCl, 1.5 mM MgCl₂, and 300 mM sucrose) supplemented with 1% PFA and 2.5% Triton X-100 for 15 min at room temperature. The fixed cells were washed three times for 5 min in PBS. After washing, the cells were preincubated with 1% BSA in PBS for 30 min and then incubated with a primary antibody against γH2AX (Upstate/Millipore, #05-636) in PBS supplemented with 1% BSA for 1 h at room temperature. The cells were washed three times for 5 min with PBS. To visualize the primary antibodies, the samples were incubated with Alexa Fluor 488- or Alexa Fluor 594-conjugated secondary antibodies (Molecular Probes/Life Technologies). The DNA was counterstained with the fluorescent dye 4,6-diamino-2-phenylindole (DAPI) in PBS for 5 min at room temperature. After washing in PBS and distilled water, the samples were mounted using Dako fluorescent mounting medium (Life Technologies). The immunostained samples were analyzed using a Zeiss AxioScope A.1 fluorescence microscope (objective: Zeiss N-Achroplan 40×/0.65; camera: Zeiss AxioCam MRm; acquisition software: Zeiss AxioVision Rel. 4.8.2; Jena, Germany). The images were processed using ImageJ software (version 1.44) and Adobe Photoshop CS6.

SA-β-galactosidase assay

The cells were fixed in 2% formaldehyde and 0.2% glutaraldehyde in PBS for 5 min at room temperature. Then, the cells were washed three times in PBS for 5 min and incubated in staining solution (1 mg/ml 5-bromo-4-chloro-3-indolyl β-D-galactopyranoside (X-gal; Sigma-Aldrich), 40 mM citric acid/sodium phosphate buffer, pH 6.0, 150 mM NaCl, 2 mM MgCl₂, 5 mM K₃Fe(CN)₆, and 5 mM K₄Fe(CN)₆) for 18 h at 37°C. Then, the samples were washed in PBS for 5 min and fixed with methanol for 5 min at room temperature.

Neutral comet assay

After illumination, the cells were immersed in Versen solution and incubated at 37°C for 5 min. The cell suspension was then mixed in a 1:1 ratio with a Trevigen LMAgarose (#4250-050-02) at 37°C. The mixture was pipetted onto comet slides (Trevigen, #3950-300-02) that had been precoated with a 1% normal melting point agarose base layer. The drop containing the cells was covered with a glass cover slip and incubated at 4°C for 5 min. The cover slips were removed, and the slides were then immersed in lysis solution (30 mM EDTA, 0.5% SDS, and 10 mM Tris-HCl, pH 8.0, supplemented with 200 mg/ml proteinase K (Sigma-Aldrich)) at 37°C for 1 h. After lysis, the slides were washed three times for 5 min in PBS and incubated in 1x TBE for 20 min at 4°C. Electrophoresis was performed in a Trevigen electrophoresis system (#4250-050-ES) for 20 min at 4°C and 1 V/cm in 1x TBE. After washing with PBS, the slides were stained with a 1:3000 dilution of SYBR Green (Thermo Scientific, #S7563). The comets were visualized at 4x magnification using an inverted Nikon Eclipse Ti-E fluorescence microscope equipped with a Nikon Intensilight C-HGFI light source (objective: Nikon Plan Fluor 4x/0.13; camera: DS-Qi2). The images of the comets were analyzed with the CometScore software. Statistical analysis was performed using IBM SPSS Statistics 20.

Alkaline comet assay

The preparation of the samples and slides was similar to the neutral comet assay. The slides were immersed in lysis solution (10 mM Tris-base, 2.5 M NaCl, 100 mM EDTA, 1% Triton X-100, and 10% DMSO, pH 10.0) for 1 h at 4°C in the dark. Then, the slides were immersed in unwinding buffer (300 mM NaOH and 1 mM EDTA, pH 13.0) for 20 min at 4°C. The slides were subjected to electrophoresis in a Trevigen electrophoresis system (#4250-050-ES) for 20 min at 4°C and 0.7 V/cm in unwinding buffer. After electrophoresis, the slides were neutralized with 500 mM Tris-HCl, pH 8.0, and stained with a 1:3000 dilution of SYBR Green (Thermo Scientific, #S7563). The comets were visualized at 4x magnification using an inverted Nikon Eclipse Ti-E fluorescence microscope equipped with a Nikon Intensilight C-HGFI light source (objective: Nikon Plan Fluor 4x/0.13; camera: DS-Qi2). The images of the comets were analyzed with the CometScore software. Statistical analysis was performed using IBM SPSS Statistics 20.

RNA isolation and reverse transcription quantitative PCR

The total RNA was extracted from the cells using TRIzol reagent (Life Technologies), and cDNA synthesis was performed at 42°C for 1 h using 0.5 µg of the total RNA as a template, 0.4 μg of random hexamer primers and 200 U of reverse transcriptase (Fermentas) in the presence of 20 U of ribonuclease inhibitor (Fermentas). The obtained cDNAs were analyzed by quantitative polymerase chain reaction (PCR) using the CFX96 real-time PCR detection system (Bio-Rad Laboratories). Each reaction contained 50 mM Tris-HCl, pH 8.6, 50 mM KCl, 1.5 mM MgCl₂, 0.1% Tween-20, 0.5 μM each primer, 0.2 mM dNTPs, 0.6 μM EvaGreen (Biotium), 0.75 U of Hot Start Taq Polymerase (Sibenzyme) and 50 ng of cDNAs. The PCR cycling conditions were as follows: initial denaturation for 5 min at 94°C, 40 cycles of 15 s at 94°C, 30 s at 65°C and 15 s at 72°C. The gene-specific primer pairs were: GAPDH - aaactgtggcgtgatggc and cagtggggacacggaagg; p16 – acaactgcccccgccacaac and acagtgaaaaggcagaagcggtg; p21 – aaggcagggggaaggtgggg and gggggagggacagcagcaga; H2B-tKR – cagccaccacacctacgag and tgaagccgatgaaggccag; H2B-miniSOG – gctttgtgattaccgatccgc and attttctgcacggtggcttg.

Whole-cell extracts preparation and immunoblotting

HeLa cells were lysed by incubation in RIPA buffer (150 mM NaCl, 1% Triton X-100, 0.5% sodium deoxycholate, 0.1% SDS, 50 mM Tris-HCl (pH 8.0), 1 mM dithiothreitol, and 1 mM PMSF) supplemented with Protease Inhibitor Cocktail (Sigma-Aldrich) and Phosphatase Inhibitor Cocktail 2 (Sigma-Aldrich) for 30 min on ice. Next, the cell extracts were sonicated with a VirSonic 100 ultrasonic cell disrupter and stored at -70°C. The protein concentration was measured by the Bradford assay. Aliquots of each sample were separated by SDS–PAGE and blotted onto PVDF membranes (Amersham/GE Healthcare). The membranes were blocked for 1 hr in 2% ECL Advance blocking reagent (GE Healthcare) in PBS containing 0.1% Tween 20 (PBS-T) followed by overnight incubation with a primary antibody diluted in PBS-T containing 2% blocking reagent. After three washes with PBS-T, the membranes were incubated for 1 hr with the secondary antibodies (horseradish peroxidase-conjugated anti-rabbit or anti-mouse IgG) in PBS-T containing 2% blocking agent. The immunoblots were visualised using a Pierce ECL plus western blotting substrate.