Portulaca oleracea L. polysaccharide inhibits ovarian cancer via inducing ACSL4-dependent ferroptosis

Cell culture

Ovarian cancer cell lines SKOV3 and Hey were purchased from Punosai (https://www.procell.com.cn/, Wuhan City, China). Ovarian epithelial cells HOSE were purchased from American Type Culture Collection (ATCC, Manassas, VA, USA). The cells were cultured in RPMI-1640 medium with 10% fetal bovine serum and 1% penicillin-streptomycin in a cell culture incubator at a constant temperature of 37°C and 5% CO₂.

Cell-counting-kit-8 (CCK-8) assay

SKOV3, Hey and HOSE cells were cultured to logarithmic growth, digested with 0.1% EDTA-containing trypsin (Sigma-Aldrich; Merck KGaA), centrifuged, and resuspended in complete medium. After that, the concentration of suspension was counted and adjusted to 1 × 10⁵ cells/900 μl. Then, 10 μl of Portulaca oleracea L. Polysaccharide (POL, purity: 98%, Shaanxi Snout Biotechnology Co., Xi’an city, China; working solution concentration gradients were 25, 50, 100, 200, 400, 800, 1600 μg/ml) was added to the 96-well plate and 90 μl of cell suspension was added. After 48 h of incubation, the supernatant was discarded. Subsequently, 110 μl CCK-8 working solution (100 μl complete medium + 10 μl CCK-8 reagent) was added and incubated at 37°C for 30 min. Then, the OD450 was determined and the IC50 of the drug on different cells was calculated.

5-ethynyl-2’-deoxyuridine (EdU) cell proliferation assay

SKOV3 and Hey cells were inoculated in six-well plates at 5 × 10⁵/well and incubated at 37°C for 48 h. We diluted EdU (10 mM) with pre-warmed cell culture solution in advance, prepared a working solution of EdU at a concentration of 20 μM, and added it to the six-well plates (1 ml/well) and incubated at 37°C for 2 h. After the supernatant was discarded, the cells were fixed with 1 ml of 4% paraformaldehyde (Beijing Solarbio Science and Technology Co., Ltd.) in each well of the six-well plate for 15 min at room temperature. After three washes with PBS, 1× Hoechst 33342 working solution (Beijing Solarbio Science and Technology Co., Ltd.) was added to each well and incubated for 5 min at room temperature. Then, the cells were observed under a fluorescence microscope and counted.

Flow cytometry assay

SKOV3 and Hey cells were inoculated in six-well plates at 5 × 10⁵/well and incubated at 37°C for 48 h. After collecting the culture fluid, we centrifuged the cell suspension at 4°C for 10 min at 1000 rpm and discarded the supernatant. Cells were resuspended with 250 μl binding buffer and the concentration was adjusted to 1 × 10⁶/ml. 100 μl of cell suspension was then incubated with 5 μl Annexin-V-PE and 10 μl 7-AAD (Annexin V-PE/7-AAD Apoptosis Detection Kit, Beijing BioLab Technology Co.) at room temperature for 15 min and subsequently analyzed by flow cytometry (CytoFLEX, Life Sciences). Data processing was performed using FlowJo TM10 software (Shanghai, China).

Real-time quantitative PCR (RT-qPCR)

Cellular RNA was extracted by RiboPure RNA Purification Kits (Thermo Fisher), and RNA purity and concentration were determined by Nano Drop 2000 (Thermo Fisher). After that, SuperScript IV Reverse Transcription Kit (Thermo Fisher) was used to reverse transcribe the RNA into cDNA (the reaction program was 15 min at 37°C, 5s at 85°C, and 5 min at 4°C), and quantitative PCR was carried out by a 2 × SYBR Green qPCR master mix (Tarkara). qRT-PCR reaction system was (10 μl): 2 × SYBR Premix, 5 μl of SYBR Green qPCR master mix, 5 μl of SYBR Green qPCR master mix, 5 μl of SYBR Green qPCR master mix, 5 μl of SYBR Green qPCR master mix. The qRT-PCR reaction system was (10 μl): 2 × SYBR Premix, 5 μl; F-primer (10 μM), 0.4 μl; R-primer (10 μM), 0.4 μl; cDNA, 2 μl cDNA, 2 μl;dd H₂O, 2 μl. Reaction procedures were: 95°C for 2 min, 40 cycles (95°C for 5s, 60°C for 30s), 95°C for 5s. GAPDH was used as an internal reference and the relative gene content was detected by the 2^−ΔΔCt method. The primer sequences were as follows:

F-ptgs2 (prostaglandin-endoperoxide synthase 2): CTGTGTCAAGCACTGTGGGT; R-ptgs2: ACACAACCCAAATTCCCAGGT; F-Chac1 (ChaC glutathione specific gamma-glutamylcyclotransferase 1): CTCAGCCCAGCCATCCATAG; R-Chac1: CAAGTGGGTAAGAGGCCCAG; F-GAPDH (glyceraldehyde-3-phosphate dehydrogenase): CCAGCAAGAGCACAAGAGGA; R-GAPDH: GGGGAGATTCAGTGTGGTGG.

Transwell assay

Cells (2 × 10⁴ cells/100 μl) were spread in the upper chamber coated or uncoated with 50 μl of Matrigel (BD Biosciences, USA) serum-free medium. Meanwhile, RPMI-1640 containing 10% FBS was added to the lower chamber. After incubation at 37°C for 12 h, cells migrating to the bottom of the membrane were fixed with 4% paraformaldehyde (Beijing Solarbio Science and Technology Co., Ltd.) and stained with crystal violet solution for 30 min. All cells were counted under a microscope at 200× magnification.

Scratch test

Logarithmic growth stage cells were selected and inoculated in 6-well culture plates. Then, 20 μl pipette tip was used to scratch the line vertically in the 6-well plates. PBS was used to wash away the floating cells, and complete medium containing different POL concentrations was added. After that, the pictures were taken under the microscope at 24 h. Migration rate was calculated, and all the experiments were repeated for three times.

Lipid peroxidation

Log phase SKOV3 and Hey cells were inoculated at a density of 1 × 10⁵/cell in six-well plates at 37°C for 24 h. After the cells were adhered overnight, the cells were sequentially divided into control group and POL group for 24 h. Then C11 BODIPY 581/591 working solution (2 μM, MCE, USA) was added, and incubated at 37°C for 30 min. The cells were then photographed with a fluorescence microscope (Zeiss, Germany), and relative fluorescence intensities were calculated by ImageJ software.

Detection of intracellular Fe²⁺ concentration

Log phase SKOV3 and Hey cells were inoculated at a density of 1 × 105/cell in six-well plates at 37°C for 24 h. After the cells were adhered overnight, the cells were sequentially divided into control group and POL group for 24 h. The cells were then continued to be incubated with 5 μM FerroOrange (MCE, USA) at 37°C for 1 h. The cells were then photographed with a fluorescence microscope (Zeiss, Germany), and relative fluorescence intensities were calculated by ImageJ software.

Mitochondrial membrane potential (MMP) assay

1 mL of JC-1 staining working solution (Abcam, Cambridge, England) was added to 6-well plate and incubate in CO₂ incubator at 37°C for 20 min. The cells were then photographed with a fluorescence microscope (Zeiss, Germany).

Western blot

After 24 h of POL treatment, the cells were centrifuged at 3000 r/min for 10 min. Cells were washed twice with PBS, lysed by adding RIPA lysis solution (After 24 h of drug treatment, the cells were centrifuged at 3000 r/min for 10 min. Cells were washed twice with PBS, lysed by adding RIPA lysis solution for 30 min, and centrifuged at 12,000 r/min for 10 min at 4°C. We collected the supernatant, and protein concentration was determined by the BCA method (Thermo Fisher). 20 μl of the upper sample was taken for SDS-PAGE gel electrophoresis at 120 V for 1.5 h. After the electrophoresis, the membrane was washed by TBST and blocked with 8% non-fat milk at room temperature for 1 h. The membrane was incubated with ACSL4 (CST, USA) and GAPDH (CST, USA) primary antibody (1:1000) at 4°C overnight, and then the secondary antibody (Beijing Solarbio Science and Technology Co., Ltd., 1:5000) was added and incubated at room temperature for 1 h. The membrane was washed with TBST, and the intensity was developed by ECL method. The relative expression of target protein was analyzed by ImageJ software, and the relative expression of target protein was represented by the gray value of target protein bands/GAPDH bands.

Determination of reduced glutathione (GSH) and malondialdehyde (MDA)

Cells were inoculated into 6-well plates and collected after full growth. The intracellular GSH and MDA levels were determined using the reduced glutathione (GSH) assay kit (Beijing Solarbio Science and Technology Co., Ltd.) and malondialdehyde (MDA) assay kit (Beijing Solarbio Science and Technology Co., Ltd.). The experimental procedures were carried out in strict accordance with the instructions.

Nude mice tumor assay

Nude mice (Sipeifu biotech, Beijing, China) were acclimatized and fed for one week to prevent stress caused by changes in the environment and feeding conditions. SKOV3 cells were collected and the concentration was adjusted to 5 × 10⁸/ml. Nude mice were induced by ether anesthesia, and then anesthetized by intraperitoneal injection of 1% pentobarbital sodium solution at a dose of 10 μl/g body weight. After the nude mice were completely anesthetized, the abdominal wall was disinfected and 10 μl of cell suspension was injected with a micro syringe. Two weeks later, all the nude mice were randomly grouped into the PBS group and the POL group, and 100 μl of PBS or POL was injected twice a week at a dose of 50 mg/kg for 3 weeks. During this period, the nude mice were closely observed in terms of their appetites, spirits and body weights. After the drug administration, the mice were asphyxiated by CO₂, some fresh tissue samples were directly embedded by OCT, and some other tissues were cut into small pieces and stored at −80°C in a low-temperature refrigerator.

Immunohistochemistry (IHC)

Tumor tissues obtained from previous animal experiments were fixed with 4% paraformaldehyde. After further dewaxing and dehydration for antigen repair, washing, sealing, the slides were incubated with anti-ACSL4 antibody (1:100) at 4°C overnight. The sections were rinsed 3 times with 1× PBS slowly, and the tissue on the sections was incubated with the secondary antibody for 15 min followed by prepared DAB color development solution at room temperature for 5 min. Subsequently, the blocks were re-stained, differentiated, reversed blue, dehydrated and transparent. Finally, a small amount of neutral resin was added and the coverslips were sealed. And representative images were taken with a Nikon DS-Ri2 microscope.

TdT-mediated dUTP nick end labeling (TUNEL)

Tumor tissues obtained from previous animal experiments were fixed with 4% paraformaldehyde. After further dewaxing and dehydration for antigen repair, washing, sealing, sections were blocked with PBS containing 5% goat serum (BSA) for 1 h at room temperature, followed by three rinses with TBST at room temperature. The Enzyme Solution and Label Solution were mixed 1:10 and kept away from light. A drop of 20 ul mixture was added to each slide and incubated for 10 min at room temperature away from light and rinsed three times with PBS at room temperature. Subsequently, 10 μl of DAPI staining solution was added to each slide and incubated at room temperature for 5 min. After rinsing with PBS for three times at room temperature, the slides were sealed with sealing agent, and the results were observed under a fluorescence microscope. By image pro software, the positive points of DAPI were counted as the total number of cells, and the positive points of TUNEL were counted as the tunel points (TUNEL/DAPI × 100% as the ratio of apoptotic cells).

Statistical analysis

All the data were analyzed and graphed using GraphPad Prism software. The experimental data are presented as the mean ± SD. Two-group comparisons were analyzed by Student’s two-sided t-test, and multiple group comparisons were analyzed by one-way ANOVA + Tukey’s two-sided test. P < 0.05 was statistically significant.

POL reduces ovarian cancer cell proliferation in a dose-dependent manner

First, we examined the effect of POL on the malignant proliferation of ovarian cancer cells. As shown in Figure 1A, 1B, POL decreased the viability of SKOV3 and Hey cells in a dose-dependent manner. Among them, in SKOV3 cells, the IC50 was 56.7 μg/ml; while in Hey cells, the IC50 was 102.5 μg/ml. In the next experiments, we chose 50 and 100 μg/ml of POL to treat SKOV3 and Hey cells, respectively. We also tested whether the same concentration of POL affected the proliferation of HOSE in mammary epidermal cells. CCK-8 assay revealed that the same concentration of POL had almost no effect on the proliferation of HOSE (Figure 1C). Moreover, POL at 24 h, 48 h, 72 h, 50 and 100 μg/ml attenuated the viability of SKOV3 and Hey cells and showed a time gradient dependence (Figure 1D, 1E).

Figure 1. POL reduced the proliferation of ovarian cancer cells in a dose-dependent manner. CCK-8 was assayed whether 25, 50, 100, 200, 400, 800, 1600 μg/ml of POL reduced the cell viability of SKOV3 (A), Hey (B) as well as HOSE (C). At 24 h, 48 h, and 72 h, 50 and 100 μg/ml of POL attenuated the viability of SKOV3 (D) and Hey (E) cells. ^**P < 0.01; ^***P < 0.001 vs. Con.

POL inhibits migration and induces cell death in ovarian cancer cells

Scratch assay revealed that 50 and 100 μg/ml of POL significantly inhibited the migration of SKOV3 and Hey cells at 48 h (Figure 2A, 2B). Similarly, transwell assay also confirmed that POL could effectively inhibit the migration rate of SKOV3 and Hey cells (Figure 2C, 2D). Flow cytometry results revealed that 50 and 100 μg/ml of POL significantly increased the mortality of SKOV3 and Hey cells (Figure 2E, 2F). These results suggested us that POL could effectively improve the malignant proliferative phenotype of ovarian cancer in vitro.

Figure 2. POL inhibits migration and induces cell death in ovarian cancer cells. Scratch assay revealed that 50 and 100 μg/ml of POL significantly inhibited the migration of SKOV3 (A) and Hey (B) cells at 48 h (4×). Transwell assay revealed that POL effectively inhibited the migration of SKOV3 (C) and Hey (D) cells (20×). Flow cytometry results assay revealed that 50 and 100 μg/ml of POL significantly increased the mortality of SKOV3 (E) and Hey (F) cells. ^*P < 0.05, ^**P < 0.01, ^***P < 0.001 vs. Con.

POL induces ferroptosis in SKOV3 and Hey cells

Next, we analyzed by which way POL induced SKOV3 and Hey cell death. W SKOV3 and Hey cells were pre-incubated with an apoptosis inhibitor (Z-VAD-FMK, 20 μM), an autophagy inhibitor (3-methyladenine, 3-MA, 20 μM), a necrosis inhibitor (Necrostatin-1, Nec-1, 10 μM), and a Ferroptosis inhibitor (Ferrostatin-1 (Fer-1) and Deferoxamine (DFO), 1 μM) for 1 h, followed by continued co-incubation with POL for 24 h. As a result, it was found that only Fer-1 and DFO were able to reverse POL-induced decrease in ovarian cell viability (Figure 3A, 3B). Specifically, in SKOV3 and Hey cells, POL reduced the viability of SKOV3 and Hey cells to 45% and 50%, respectively, compared with the control. In contrast, Fer-1 (a lipid ROS scavenger) and DFO (an iron chelator) elevated SKOV3 and Hey cell viability to 67%, 77% and 78%, 74%, respectively. When the two were combined, SKOV3 and Hey cell viability increased to 98% and 90%, respectively (Figure 3A, 3B), suggesting that POL-induced ferroptosis is driven by iron-dependent lipid peroxidation. We further explored the effects of POL on two markers of ferroptosis, ptgs2 and Chac1. POL was able to significantly increase the mRNA levels of ptgs2 and Chac1 in SKOV3 and Hey cells (Figure 3C–3F). These results suggest that ferroptosis plays a dominant role in POL-induced cell death in ovarian cancer.

Figure 3. POL induced ferroptosis in SKOV3 and hey cells. CCK-8 assay showed that ferroptosis inhibitor, Fer-1 and DFO, were able to reverse the POL-induced decrease in cell viability of SKOV3 (A) and Hey (B) cells. RT-PCR analysis showed that POL was able to significantly increase the mRNA levels of ptgs2 and Chac1 in SKOV3 (C, D) and Hey (E, F) cells. ^*P < 0.05, ^***p < 0.001 vs. Con; ^#P < 0.05, ^##P < 0.01, ^###P < 0.001 vs. POL.

POL increases ACSL4 expression in a concentration gradient-dependent manner

We examined the effect of POL on MMP. As shown in Figure 4A, 4B, JC-1 was mainly present as JC-1 monomers in the control group, whereas after POL treatment, JC-1 was mainly present as JC-1 dimers, suggesting that POL induced a decrease in mitochondrial MMP, which led to mitochondrial dysfunction and triggered ferroptosis (Figure 4A, 4B). Meanwhile, POL significantly increased Fe²⁺ levels in SKOV3 and Hey cells (Figure 4C, 4D). We further detected the changes in ferroptosis-related protein expression. The results, as shown in Figure 4E, 4F, showed that POL increased the protein expression level of ACSL4 in a concentration gradient-dependent manner.

Figure 4. POL increased ACSL4 expression in a concentration gradient-dependent manner. JC-1 analysis showed that POL decreased MMP in SKOV3 (A) and Hey (B) cells (20×). FerroOrange staining showed that POL increased Fe²⁺ levels in SKOV3 (C) and Hey (D) cells (20×). Western blot assay revealed that POL increased the protein expression level of ACSL4 in SKOV3 (E) and Hey (F) in a concentration gradient-dependent manner. ^**P < 0.01, ^***p < 0.001 vs. Con.

Knockdown of ACSL4 reverses POL-induced ferroptosis in ovarian cancer cells

Next, we screened siRNAs specifically targeting ACSL4. si-ACSL4 effectively suppressed ACSL4 expression in SKOV3 and Hey cells as shown in Figure 5A, 5B. Meanwhile, POL-induced high ACSL4 expression was reversed to some extent by si-ACSL4 (Figure 5A, 5B). In addition, we examined the effect of POL on cell proliferation by EdU staining. Compared with the control group, POL reduced the proliferation of SKOV3 and Hey cells, and si-ACSL4 could reverse this effect (Figure 5C, 5D). Also, silencing ACSL4 reduced POL-induced lipid peroxidation in SKOV3 and Hey cells (Figure 5E, 5F). This result confirms that ACSL4 plays a major role in POL-mediated ferroptosis in ovarian cancer cells.

Figure 5. Knockdown of ACSL4 reverses POL-induced ferroptosis in ovarian cancer cells. Western blot assay revealed that POL-induced high expression of ACSL4 was reversed to some extent by si-ACSL4 in SKOV3 (A) and Hey (B) cells. EdU staining showed that POL decreased the proliferation of SKOV3 (C) and Hey (D) cells, and si-ACSL4 could reverse this effect (20×). Silencing ACSL4 also reduced POL-induced lipid peroxidation in SKOV3 (E) and Hey (F) cells (40×). ^*P < 0.05, ^**p < 0.01 vs. Con; ^#P < 0.05, ^##P < 0.01 vs. POL.

POL inhibits tumor growth in mice in vivo

Next, we explored the effect of POL on tumor volume in mice in vivo. As shown in Figure 6A, 6B, POL significantly reduced tumor weight and volume. At the same time, POL increased the levels of ROS and MDA in mouse tumor tissues (Figure 6C, 6D). Conversely, POL decreased GSH levels in mouse tumor tissues (Figure 6E). TUNEL staining revealed that POL increased cellular mortality in tumor tissues (Figure 6F). IHC staining revealed that POL increased the levels of ACSL4 in tumor tissues (Figure 6G). RT-PCR results revealed that POL increased mouse tumor mRNA levels of ptgs2 as well as chac1 in the tissues (Figure 6H). Western blot similarly confirmed that POL increased the protein expression levels of ACSL4 in mouse tumor tissues (Figure 6I). These results suggest that POL is an effective cancer inhibitor.

Figure 6. POL inhibited tumor growth in mice in vivo. POL significantly reduced the weight (A) and volume (B) of mouse tumors. POL increased the levels of ROS (C) and MDA (D) in mouse tumor tissues. (E) POL decreased GSH levels in mouse tumor tissues. (F) TUNEL staining revealed that POL increased the cell death rate in tumor tissues (20×). (G) IHC staining revealed that POL increased the level of ACSL4 in tumor tissues (20×). (H) RT-PCR results revealed that POL increased the mRNA levels of ptgs2 as well as chac1 in mouse tumor tissues. (I) Western blot similarly confirmed that POL increased the protein expression level of ACSL4 in mouse tumor tissues. ^**P < 0.01, ^***p < 0.001 vs. Con.