miR-638 suppresses DNA damage repair by targeting SMC1A expression in terminally differentiated cells

miR-638 is up-regulated in terminally differentiated cells

In our previous study, we identified miR-638 as a novel regulator of myeloid differentiation in leukemic cells and presented its impacts on cell cycle arrest and proliferation [14]. Given that the differentiated cell is commonly regarded as having progressively attenuated DNA repair [2], and miR-638 is involved in DNA damage repair processes by targeting BRCA1 expression [16, 41], we intended to further explore the role of miR-638 in the DNA damage repair of terminally differentiated cells. We first measured the expression level of miR-638 in terminally differentiated myeloid cell lines. K562 is a typical acute myeloid leukemia cell line that can be induced by phorbol myristate acetate (PMA) to differentiate into mega-karyocytic-like cells. As shown in Figure 1A, along with the increased expression of the megakaryocyte-specific surface marker (CD41a) [50], the expression of miR-638 exhibited a four-fold increase at 96 hours after PMA-induced megakaryocytic differentiation when compared with that of untreated control cells. A noticeable up-regulation of miR-638 expression was also observed in another promyelocytic leukemic cell line, HL-60, which can differentiate into monocytic/macrophage- or granulocytic-like phenotypes by PMA or dimethyl sulfoxide (DMSO) treatment, respectively (Figure 1B and 1C). Increased macrophage- (CD14) or granulocytic-specific (CD11b) surface markers were measured by flow cytometry to confirm differentiation [51]. These results show that miR-638 expression was up-regulated during the terminal differentiation of cells.

SMC1A and BRCA1 are two target genes of miR-638 and are down-regulated in terminally differentiated cells

To investigate the functional mechanism of miR-638 in cellular differentiation, we performed TargetScan analysis [52]. We selected SMC1A, which is a member of the structural maintenance of chromosomes family [53], as a potential target gene of miR-638. Using RNAhybrid [54], a putative binding site in the 3′-UTR of SMC1A was predicted to have a minimum free energy hybridization of −30.5 kcal/mol (Figure 2A). To verify this prediction, a luciferase reporting experiment was conducted. We constructed two luciferase reporter vectors that harbored the wild-type 3′-UTR of SMC1A (SMC1A-WT) or the mutant 3′-UTR of SMC1A (SMC1A-MUT) (Figure 2A). In comparison with the control (scrambled mimic), transient transfection with miR-638 mimics caused a 30% reduction in luciferase activity for the wild-type 3′-UTR of SMC1A (SMC1A-WT). However, the mutation in the 3′-UTR had almost no inhibitory effect on the luciferase activity of overexpressed miR-638 (Figure 2B). Therefore, we concluded that miR-638 could directly regulate SMC1A by targeting its 3′-UTR region.

To further verify SMC1A as a novel target gene of miR-638, we measured the expression change of SMC1A in terminally differentiated myeloid cells. The mRNA and protein expression levels of SMC1A were significantly decreased in K562 and HL-60 cells after PMA- or DMSO-induced differentiation (Figure 3A). We also tested the expression level of BRCA1, which is another miR-638 target gene [43], in differentiated myeloid cells. Similarly, induced differentiation noticeably decreased BRCA1 mRNA and protein expression (Figure 3B).

All of these findings confirmed that the expression of miR-638 was inversely correlated with the expression of SMC1A, thus suggesting that SMC1A and BRCA1 are the target genes of miR-638 during cell differentiation.

miR-638 overexpression attenuates DNA repair ability in terminally differentiated cells

The DNA repair process was recently reported to be dependent on cell type and differentiation stage. In terminally differentiated cells, DNA damage repair is less efficient. However, the mechanisms by which DNA repair is regulated during differentiation are still unclear [2, 55]. Here, we show that miR-638 expression was significantly up-regulated in differentiated cells. Previously, the studies showed that miR-638 affects DNA repair by mediating BRCA1 expression [16, 41]. We then hypothesized that miR-638 might play a role in impeding DNA repair ability during cell differentiation. The persistence of DSBs is an indicator of unrepaired DNA damage, and we performed the comet assay in differentiated K562 and HL-60 cells to measured this. The comet tail moment quantifies the extent of unrepaired DNA damage [8]. Consistent with the previously reported study [56], we found an significant increase in the comet tail moment of terminally differentiated cells following cisplatin treatment (Figure 4A and 4B). Next, we examined the comet tail moment of K562 cells that were transfected with transient miR-638 mimics. The transfection efficiency was evaluated by qRT-PCR. The expression of miR-638 was apparently increased in mimics-638-transfected cells, and the mRNA and protein levels of its targeting genes (SMC1A and BRCA1) were accordingly down-regulated (Figure 5A). At 48 hours after transfection, cells were treated with cisplatin to induce DNA damage, and the comet tail moment was measured after 18 h. As shown in Figure 5B, compared to cells transfected with control mimics (mimics-NC), a significant increase in comet tail moment is detected after cisplatin treatment.

Because of the impairment in DNA repair ability, the sensitivity of the cell to genotoxic drugs will increase. Next, we tested the cell viability of miR-638-overexpressing K562 cells. Cisplatin (50 μM) treatments had almost no effect on the viability of mimics-NC-transfected cells (Figure 5C). However, miR-638 overexpression noticeably down-regulated cell viability. We attributed this down-regulation of cell viability to the inhibitory effect of miR-638 overexpression on DNA repair.

In addition, we performed the comet assay and cell viability measurement in U2OS cell, which is an ideal model for studying DNA damage repair processes. Because U2OS cells express high levels of endogenous miR-638 [17], we generated a stable U2OS cell line by retrovirus transfection, in which the level of miR-638 was inhibited for about 70% (Figure 6C). The protein level of SMC1A was then accordingly increased, thus confirming the suppressed miR-638 expression (Figure 6D). Contrary to miR-638-overexpressing K562 cells, the down-regulation of miR-638 in U2OS cells evidently decreased the comet tail moment following bleomycin or cisplatin treatments (Figure 6A and 6B). Moreover, the cellular sensitivity to a high con-centration of cisplatin (≥100 μM) was reduced in miR-638-down-regulated cells (SD-miR-638), although a low concentration of cisplatin (20 μM) had no effect on cell viability (Figure 6E).

Overall, these results demonstrated a modulatory effect of miR-638 on DNA repair ability during cell differentiation.

miR-638 affects DNA repair ability and cell sensitivity to cisplatin by mediating SMC1A expression

Kitagawa et al. previously confirmed the role of SMC1A in the ATM-NBS1-BRCA1 pathway in response to DNA damage after IR [49]. SMC1A, which forms a complex with BRCA1, can be recruited at DNA break sites and then phosphorylated by ATM [49]. Therefore, to test whether the effect of miR-638 on DNA repair is partly regulated via the reduction in SMC1A expression, we restored SMC1A protein levels in miR-638-overexpressing K562 cells by co-transfecting cells with an exogenous plasmid that carried the coding sequence (CDS) region of SMC1A cDNA (without the miR-638 binding region, 3′-UTR). In addition, three Flag tags were constructed at the 3′ end of the SMC1A CDS region to allow for the detection of transfection efficiency using a Flag antibody. A noticeable Flag band of the exogenous SMC1A plasmid-transfected group indicated that the suppressed SMC1A protein level, which was caused by increased miR-638 expression, was restored (Figure 7C). We found that the comet tail moment in miR-638-overexpressing cells was higher than that in negative control-transfected cells, and co-transfection with the vector plasmid had no effect on tail moments. However, when miR-638-overexpressing cells were co-transfected with the SMC1A plasmid, a 40% reduction in the comet tail moment was significantly observed (Figure 7A and 7B), which indicated the decreased of unrepaired DNA damage.

We further verified this on miR-638 down-regulated U2OS cells (SD-miR-638). The increased protein level of SMC1A in SD-miR-638 U2OS cells has already been proved (Figure 6D), and siRNAs against SMC1A were transfected into SD-miR-638 U2OS cells. The knockdown efficiency of siRNAs was validated by western blot, and the significant knockdown of SMC1A protein expressions were detected (Figure 7F). We found that the knockdown of SMC1A (by siRNA#1, #2, #3) increased the comet tail moment of SD-miR-638 U2OS cells, whose unrepaired DNA damage was reduced owing to miR-638 down-regulation (Figure 7D and 7E).

These findings suggest that the obstruction of miR-638 on DNA repair ability is partly mediated by its effect on SMC1A protein expression.

miR-638 expression influences γH2AX expression and foci formation in the nucleus

H2AX has been identified as one of the key histones to undergo various post-translational modifications in response to DNA double-strand breaks (DSBs) and its phosphorylation and recruitment at DNA break sites serves as an indicator of DNA damage repair processes [57, 58]. Thus, we detected the protein level and nuclear foci formation of γH2AX to identify the mechanism by which miR-638 mediates DNA damage repair processes. First, we observed an increase in γH2AX protein levels in mimics-638-transfected cells (Figure 8A). Simultaneously, an enhanced γH2AX foci formation in the nucleus was observed in mimics-638-transfected cells (Figure 8B a-h, 8C), suggesting that miR-638 may play a role in promoting γH2AX protein expression and foci formation in the nucleus. In addition, we tested the protein level and nuclear foci formation of γH2AX in both mimics-638- and mimics-NC-transfected cells following 30 min of cisplatin treatment. Upon transient cisplatin treatment, the protein levels of γH2AX in both mimics-638- and mimics-NC-transfected cells were increased. Moreover, this up-regulation in mimics-638-transfected cells was even more evident than that in control cells (Figure 8A), indicating that miR-638 can promote the cellular DNA damage response to DSBs. Consistently, the foci formations of γH2AX in the nucleus were also augmented after 30 min of cisplatin treatment, and the overexpression of miR-638 made this recruitment even more obvious (Figure 8B i-p, 8C).

These findings confirmed the influence of over-expressed miR-638 on DNA damage repair and showed that miR-638 affected the protein expression and recruitment of the DNA repair-related protein, γH2AX.

Cell culture and differentiation

K562 cells and HL-60 cells were grown in RPMI-1640 supplemented with 10% (v/v) fetal bovine serum (FBS). U2OS cells were grown in Dulbecco's Modified Eagle Medium (DMEM) supplemented with 10% (v/v) FBS. We treated K562 cells (5×10⁵ cells/ml) with PMA (10 mg/ml, 96 h) for differentiation into megakaryocytes. HL-60 cells (5×10⁵ cells/ml) were treated with PMA (120 nM, 72 h) or DMSO (1.25%, 120 h) for differentiation into macrophages or granulocytes, respectively.

RNA isolation and quantitative real-time RT-PCR

Total RNA was obtained using the Direct-zol RNA Miniprep (ZYMO RESEARCH, USA), and 1 μg total RNA was subjected to reverse transcription using the FastQuant RT Kit (with gDNase) (TIANGEN, China). Quantitative analyses of mRNA levels were performed using SYBR Select Master Mix (Life Technology, USA). Primers are provided in Table 1. Reverse transcription and quantitative analyses of miR-638 were performed using the one-step miRNA cDNA Synthesis Core Reagent Kit and SYBR Premix HS SM-Taq (Geneup, Shenzhen, China). GAPDH and Snord44 small nuclear RNA were used as internal controls for mRNA and miRNA quantification, respectively. The levels of mRNAs and miRNAs were determined by the 2^−ΔΔCt method.

Oligonucleotide transfection

Negative control mimics (mimics-NC) and miR-638 mimics (mimics-638) were designed and synthesized (Geneup, Shenzhen, China). Mimics were transfected into K562 cells at working concentrations of 100 nM using Lipofectamine 3000 (Invitrogen, USA). A fragment from the CDS of SMC1A mRNA (without the 3′-UTR region), which disrupted the binding sites by miR-638, was cloned into the pCNV-3 tag-8 expression vector (Stratagene, USA). Mimics-638 (100 nM) and the SMC1A plasmid (2 μg) or vector plasmid (2 μg) were co-transfected into K562 cells using Amaxa nucleofection (Amaxa, Germany). SMC1A siRNA (#1 CGGCGTATTGATGAAATCAAT, #2 CCAACATTGATGAGATCTATA, #3 TAGGAGGTTCTTCTGAGTACA) or negative control siRNA were transfected into U2OS cells using Lipofectamine 3000 (Invitrogen, USA).

Generation of stably transfected U2OS cells

Retrovirus designs and packaging were performed by Geneup (Shenzhen, China). U2OS cells (80%) were seeded on 6-well plates. After U2OS cells are at 80% confluency, packaged retroviruses were added into fresh DMEM medium and cultured with U2OS cells for 24 h. and then fresh DMEM medium was added in retroviruses transfected cells. Puro-resistant gene was cloned into the retroviral vector and successfully transfected stable cell lines were selected by puromycin treatment.

Luciferase reporter assay

A fragment from the 3′-UTR of SMC1A mRNA harboring putative miR-638 binding sites was cloned into multiple sites of firefly luciferase (pMIR-REPORT luciferase vector) (Applied Biosystems, USA). To test whether SMC1A mRNA is directly regulated by miR-638, the mutant version with a seven-base mutation via overlapping PCR was also cloned into the vector. HEK293T cells were seeded on 24-well plates (1×10⁵ cells/well) and transfected with 100 ng of the reporter vectors, 10 ng pRL-TK, and miR-638 or negative control mimics (final concentration: 100 nM) using Lipofectamine 2000 reagent (Invitrogen, USA). After 48 h, we detected luciferase activities using the Dual Luciferase Assay System (Promega, USA).

Cellular viability assay

After 48 hours transfection of mimics-NC or mimics-638, K562 cells (6,000 cells per well) were re-plated on 96-well plates and treated with one of two final concentrations of cisplatin (0 or 50 μM) for 48 h. Cisplatin was dissolved in RPMI-1640. The CCK8 assay kit reagent (Promoter Biological, China) was added into every well (10 μl per well) and incubated for 2 h at 37°C, after which the optical density was read at 450 nm with a microplate reader (Biotek, USA). Each group had five replicates. Stably transfected U2OS cells (6,000 cells per well) were seeded on 96-well plates and separately treated with five concentrations of cisplatin (0, 20, 100, 200, or 400 μM) for 48 hours. Cisplatin was dissolved in DMEM. MTT ([3-4,5-dimethyl-2-thiazolyl]-2,5-diphenyl-2-H-tetra-zolium bromide; 10 μl of a 5 mg/ml solution) was added into every well and incubated for 4 hours at 37°C, and then the generated crystals were dissolved by DMSO. The optical density was read at 450 nm with a microplate reader (Biotek, USA), and each group had five replicates.

Comet assay

We induced double-strand breaks by treating cells with cisplatin (5 μM) or bleomycin (0.2 μg/ml) for 18 h at 37°C. Treated cells were collected and washed twice with phosphate-buffered saline (PBS). We performed the single-cell comet assay, according to the manufacturer's instructions (KeyGEN BioTECH, China). First, 0.5% normal-melt agarose was spread on frosted glass slides. After the agarose solidified, we spread 0.7% low-melt agarose with 10⁵ cells/ml on the first gelatin. While waiting for the second agarose coating to solidify, we spread the 0.7% low-melt agarose on the second agarose and solidified the gelatin at 4°C for 30 min. After the agarose solidified, the slides were successively placed in Lysis Buffer containing 10% DMSO at 4°C for 1 h. The slides were washed with PBS three times and placed in EDTA NaOH electrophoresis liquid at room temperature for 40 min. Electrophoresis was run for 20 min at 25 V. Slides were then washed with 0.4 mol/L Tris-HCl buffer solution three 10-min intervals at 4°C. Cells were stained with propidium iodide for 10 min in the dark. Nuclei were visualized using a fluorescence microscope and analyzed with CometScore. Fifty cells were counted in each experiment.

Protein extraction and immunoblotting

Proteins were extracted from cell lines using RIPA buffer, which was supplemented with protease inhibitors. Protein extracts were fractionated by SDS-PAGE or Tricine-SDS-PAGE using 8% polyacrylamide gels and transferred to polyvinylidene fluoride membranes (Millipore, USA). The membranes were blocked with 5% skim milk in TBS with Tween 20 (1:2000, V/V) (TBST) for 1 h at room temperature. The membranes were then incubated with primary antibodies at 4°C overnight. Afterwards, the membranes were washed with TBST three times and then incubated with secondary antibodies for 1 h at room temperature. After washing five to six times, membranes were incubated with electrochemi-luminescence western blotting substrate (Bio-red) and visualized in the darkroom. The following primary antibodies were used: anti-phosphorylated-Histone H2AX (Ser139) antibody (JBW301; Upstate; 1:2,000), anti-SMC1 (8E6) Mouse monoclonal antibody (#6892, Cell Signaling, 1:1,000), and anti-BRCA1 antibody (#9010, Cell Signaling, 1:1,000).

Immunofluorescence microscopy

K562 cells were transfected with mimics and then treated with cisplatin (25 μM) for 30 min. Afterwards, cells were collected and washed with PBS. Cells were then suspended in the wash buffer (10⁵ cells/μl) and spread on the cover glass. After the cells adhered on the glass, the glass slides were fixed with 4% paraformaldehyde in PBS for 15 min at room temperature, permeated with 0.2% Triton X-100 in PBS for 15 min at room temperature, and then blocked with 5% bovine serum albumin in PBS for 30 min at room temperature. Cells were incubated with primary antibodies at 4°C overnight. Afterwards, the cells were washed with PBS three times and incubated with secondary antibodies (Cy3 goat anti-mouse IgG) for 30 min in the dark. Cells were then stained with DAPI (1 μg/ml) in PBS for 3 min at room temperature. The anti-phosphorylated-Histone H2AX (Ser139) antibody (JBW301; Upstate, 1:1,000) was used.

Statistical analysis

Data are presented as means ± standard deviation of triplicates or duplicates. Differences between two groups were analyzed by the Student's t test (unpaired, two tails), and a p<0.05 value was considered as significant. All data analyses were performed with GraphPad Prism version 5.0 (GraphPad Software, USA).