Paeoniflorin attenuates DHEA-induced polycystic ovary syndrome via inactivation of TGF-β1/Smads signaling pathway in vivo

Effects of PAE on body weight and ovary weight in PCOS rats

To explore the effect of PAE on PCOS development, the body weight and ovary weight in PCOS rats were monitored. We found that there was no statistically significant difference on the body weights in the five groups. In comparison with SDR group, the ovary weight and the organ coefficient of the PCOSR group were markedly reduced. The treatment of high-dose PAE (Figure 1A) could significantly block the DHEA-induced decline of ovary weight and organ coefficient (P < 0.05) (Figure 1B). These data suggested that PAE had potential therapeutic effect on PCOS.

Figure 1. Influence of PAE on body weight, ovary weight, organ coefficient and estrous cycle in PCOS rats (n=10 for each group). (A) The chemical structure of PAE. (B) Influence of PAE on body weight, ovary weight and organ coefficient in PCOS rats (mean ± SEM, n=10 for each group). *P < 0.05, **P < 0.01 and ***P < 0.001 vs. SDR group. #P < 0.05, ##P< 0.01 and ###P< 0.01 vs. PCOSR group. (C) Different periods of estrous cycle (toluidine blue staining; Scale bars = 200 μm): Proestrus, Estrus, Metestrus and Diestrus. (D) Representative pictures of estrous cycle in five different groups; P, Proestrus; E, Estrus; M, Metestrus; D, Diestrus. PCOS, polycystic ovarian syndrome; SDR, normal control group; PCOSR, PCOS model group; PAE-L, PAE low-dose group (20 mg/kg/d); PAE-M, PAE middle-dose group (40 mg/kg/d); PAE-H, PAE high-dose group (80 mg/kg/d).

Effects of PAE on estrous cycle in rats with PCOS

To further confirm the effect of PAE on PCOS development, estrous cycle was detected by toluidine blue staining. The regular estrous cycle consists of four continuous periods including proestrus (P), estrus (E), metestrus (M) and diestrus (D), determined by the three kinds of vaginal epithelium cells (cornified cells, nucleated cells and leukocyte cells) [26]. The rats in PCOSR group lost the regular estrous cycle, most of which stayed in the diestrus period with the presence of a great number of leukocyte cells. By contrast, the rats in SDR group exhibited regular estrous cycle. And treatment of PAE could shorten the prolonged diestrus period and correct the irregular estrous cycle (Figure 1C, 1D), suggesting PAE played a regulative role in the estrous cycle of PCOS rats.

Effects of PAE on ovarian structure and follicle growth in PCOS rats

To further study the effect of PAE on PCOS development, the ovary structure was analyzed by H&E staining. In SDR group, multiple corpus luteum and follicles in different stages were observed from ovarian tissue slices by the microscope, and cystic dilated follicles were rarely found. Whereas in PCOSR group, the ovaries showed polycystic changes with cystic dilated follicles. The number of corpus luteum was significantly reduced, and the granular cell layer in the follicles was also reduced compared with SDR group. The above pathological changes could be effectively improved after the treatment with PAE. Compared with PCOSR group, the number of cystic dilated follicles in the ovarian was tissues decreased, while the number of corpus luteum was increased, and the granular cell layers were thickened in the ovaries in PAE-M and PAE-H groups. The improvement was most obvious in the PAE-H group (Figure 2A). These results indicated that PAE ameliorated the pathological symptoms of the ovary.

Figure 2. Influence of PAE on ovarian structure, follicle growth and ovarian collagen deposition in PCOS rats. Rats were executed at diestrus. (A) Representative pictures of ovarian tissues in PCOS rats (Hematoxylin and eosin staining, Scale bars = 500 μm, n=10 for each group). (B) Sirius red staining under a light microscope (Scale bars = 100 μm, n=10 for each group). (C) Proportion of the area containing collagen to the ovarian area (mean ± SEM, n=10 for each group). *P < 0.05, **P < 0.01 and ***P < 0.001 vs. SDR group. #P < 0.05, ##P< 0.01 and ###P< 0.01 vs. PCOSR group. PCOS, polycystic ovarian syndrome; SDR, normal control group; PCOSR, PCOS model group; PAE-L, PAE low-dose group (20 mg/kg/d); PAE-M, PAE middle-dose group (40 mg/kg/d); PAE-H, PAE high-dose group (80 mg/kg/d). “▲” is directed in the direction of collagen fibers. “→” is directed in the direction of granular cell layers. C, corpora luteum; F, cyst-like follicles; f, cyst-like follicles.

Effects of PAE on collagen deposition in PCOS rats

Sirius red staining (Figure 2B) revealed that only a few collagen fibers were present in the ovarian tissues in SDR group. In contrast, more collagen fibers were clearly observed in PCOSR group. Treatment with high-dose PAE markedly reduced ovarian fibrosis (P < 0.05), which indicated that PAE improved ovarian fibrosis and collagen deposition caused by DHEA. The analysis of the collagen areas also presented that PAE markedly reduced the collagen areas (Figure 2C).

Effects of PAE on the reproductive hormone levels in PCOS rats

To further study the effect of PAE on PCOS development, the reproductive hormone levels were determined by ELISA. Compared with SDR group, the serum levels of T, LH, and LH/FSH were markedly increased in PCOSR group (P <0.001). In PCOSR group, the serum levels of E2 (P < 0.01) and AMH (P < 0.05) showed statistical significance, whereas no statistical difference was noted in FSH (P > 0.05). In contrast, the serum levels of T, E2, LH, LH/FSH and AMH were significantly reduced in the PAE group compared with PCOSR group (P <0.05), while the serum level of FSH showed no statistical difference (P >0.05). The occurrence of hyperandrogenism and excessive LH secretion are important features of the pathophysiology of PCOS [19], indicating the PCOS model was successfully constructed in the present study. Treatment of PAE could significantly reduce the serum levels of T, LH, E2, AMH and LH/FSH in PCOS rats, which displayed that PAE could improve the reproductive hormone levels of PCOS (Figure 3A–3F). These results implied that PAE may have corrective effect on reproductive endocrine of female.

Figure 3. Influence of PAE on the reproductive hormone levels in PCOS rats (mean ± SEM, n=10 for each group). (A–D, F) The levels of serum T, E2, LH, FSH and AMH. *P < 0.05, **P < 0.01 and ***P < 0.001 vs. SDR group. #P < 0.05, ##P< 0.01 and ###P< 0.01 vs. PCOSR group. (E) The ratio of LH to FSH. *P < 0.05, **P < 0.01 and ***P < 0.001 vs. SDR group. #P < 0.05, ##P< 0.01 and ###P< 0.01 vs. PCOSR group. PCOS, polycystic ovarian syndrome; SDR, normal control group; PCOSR, PCOS model group; PAE-L, PAE low-dose group (20 mg/kg/d); PAE-M, PAE middle-dose group (40 mg/kg/d); PAE-H, PAE high-dose group (80 mg/kg/d); T, total testosterone; E2, estradiol; LH, luteinizing hormone; FSH, follicle stimulating hormone; AMH, Anti-Mullerian Hormone.

Effect of PAE on the activation of TGF-β1/Smads signaling pathway in ovarian tissues of PCOS rats

To investigate the specific mechanism underlying the effect of PAE on PCOS development, the TGF-β1/Smads signaling pathway was determined via qRT-PCR and western blot. The mRNA expression levels of TGF-β1 and Smad3 in the ovarian tissues of PCOSR group were significantly higher than those in SDR group (P < 0.001), and the mRNA expression levels of Smad7 and MMP2 in the ovarian tissues of PCOSR group were significantly lower than those in SDR group (P < 0.001). Treatment with PAE reduced the relative mRNA levels of TGF-β1 and Smad3 (P < 0.05) and increased the mRNA levels of Smad7 and MMP2 (P < 0.05) (Figure 4A–4D).

Figure 4. Influence of PAE on the activation of TGF-β1/Smads signaling pathway in PCOS rats was evaluated by qRT-PCR (mean ± SEM, n=10 for each group). (A, B) The mRNA levels of TGF-β1 and Smad3 in the ovarian tissues of PCOSR group were significantly higher than those in the SDR group (P < 0.001). The treatment with PAE reduced the mRNA levels of TGF-β1 and Smad3 (P < 0.05). *P < 0.05, **P < 0.01 and ***P < 0.001 vs. SDR group. #P < 0.05, ##P< 0.01 and ###P< 0.01 vs. PCOSR group. (C, D) The mRNA expression levels of Smad7 and MMP2 in the ovarian tissues of PCOSR group were significantly lower than those in the SDR group (P < 0.001). The Treatment with PAE increased the mRNA expression levels of Smad7 and MMP2 (P < 0.05). *P < 0.05, **P < 0.01 and ***P < 0.001 vs. SDR group. #P < 0.05, ##P< 0.01 and ###P< 0.01 vs. PCOSR group. PCOS, polycystic ovarian syndrome; SDR, normal control group; PCOSR, PCOS model group; PAE-L, PAE low-dose group (20mg/kg/d); PAE-M, PAE middle-dose group (40mg/kg/d); PAE-H, PAE high-dose group (80mg/kg/d).

The protein expression levels of TGF-β1, p-Smad3 and α-SMA in the ovarian tissues of PCOSR group were significantly higher than those in the SDR group(P < 0.001), and the protein expression levels of Smad7 and MMP2 in the ovarian tissues of PCOSR group were significantly lower than those in SDR group (P < 0.001). There was no statistically significant difference in the protein expression level of Smad3. Treatment with PAE corrected the reduction in protein expression levels of Smad7 and MMP2 (P < 0.05), and reduced the protein expression levels of TGF-β1, p-Smad3 and α-SMA (P < 0.05) (Figure 5A–5F). These results suggested that PAE attenuated DHEA-induced polycystic ovary syndrome via inhibiting TGF-β1/Smads signaling pathway in PCOS rats.

Figure 5. Influence of PAE on the activation of TGF-β1/Smads signaling pathway in PCOS rats was evaluated by western blot. The protein expressions of (A) TGF-β1, (B) p-Smad3, (C) Smad3, (D) Smad7, (E) α-SMA and (F) MMP2 were detected in ovarian tissues of PCOS rats. Same one GAPDH was used as the internal standard in (A, D, E). Same one GAPDH was used as the internal standard in (B, C, F). *P < 0.05, **P < 0.01 and ***P < 0.001 vs. SDR group. #P < 0.05, ##P< 0.01 and ###P< 0.01 vs. PCOSR group. PCOS, polycystic ovarian syndrome; SDR, normal control group; PCOSR, PCOS model group; PAE-L, PAE low-dose group (20 mg/kg/d); PAE-M, PAE middle-dose group (40 mg/kg/d); PAE-H, PAE high-dose group (80 mg/kg/d).

Animals

Fifty-eight 3-week-old female Sprague-Dawley (SD, 40-60 g) rats were supplied by the Animal Care of Nanjing Medical University (Nanjing, China). The experimental approach was overseen and approved by the Ethical Committee of Nanjing Medical University. All of the animals were kept in the plastic cages under specific pathogen-free (SPF) grade on a 12-hour light/dark cycle with a temperature of 20-24° C and humidity of 50% and given ad libitum access to sterilized food and water. Beddings of these animals were changed twice a week.

Experimental design and drug administration

Forty-eight SD rats (PCOS group, n=48) were given subcutaneous injection of 60 mg/kg/d dehydroepiandrosterone (DHEA; APExBIO Technology LLC, Houston, USA) diluted with 0.2 ml soybean for 35 consecutive days [19, 26]. The remaining rats (SDR group, n=10) were subcutaneously injected by 0.2 ml soybean oil (Shanghai Yuanye Biological Technology Co., LTD, Shanghai, China) per day. PCOS rats model was successfully established when irregular estrus cycle happened on rats. Ten PCOS rats were treated as PCOSR group (n=10), and thirty PCOS rats were divided into three groups (n=10) being administrated by gavage with Paeoniflorin (Chengdu Herbpurify Co., Ltd, Chengdu, China) on 20 mg/kg/d, 40 mg/kg/d, 80 mg/kg/d respectively [12]. Rats in SDR and PCOSR groups were treated with the same weight-based volume of distilled water by gavage for 4 weeks. All animals were euthanized under ether narcotization, and the specimens were collected for the following examinations.

Body weight, ovary weight and estrous cycles

The body weights of the rats were monitored daily, and the rat ovaries were weighed after anesthetization. Estrous cycle, constituted by proestrus (P), estrus (E), metestrus (M) and diestrus (D), was determined by three kinds of vaginal epithelium cells. Vaginal smears were daily operated between 9:00 to 10:00 A.M. from the 14^th day to the end of the study. The vaginal secretion was smeared on the glass slides, and then the slides were dyed by toluidine blue (Beijing Solarbio Science and Technology Co., Ltd, Beijing, China) for 15 min.

Blood sample analysis

Blood samples were collected from the blood in the abdominal aorta after anesthetization. After centrifugation at 3000 r/min for 10 min, the supernatants were collected and preserved for the measurements of serum testosterone (T), estradiol (E2), follicle stimulating hormone (FSH), luteinizing hormone (LH), and anti-mullerian hormone (AMH) according to the manufacturer’s protocols of the ELISA kits (Elabscience Biotechnology Co., Ltd, Wuhan, China).

Ovarian haematoxylin and eosin staining and sirius red staining

The ovarian specimens were fixed in 4% paraformaldehyde after being harvested from rats, and then were embedded in paraffin. Ovarian paraffins were sliced at 4 μm thickness. Ovarian paraffin slices were stained with hematoxylin and eosin to observe the pathological changes of ovarian structure and morphology.

Measurement of the collagen area

Ovarian paraffin slices were stained with Sirius-red staining to determine the collagen fibers in the ovarian tissues. The collagen area was calculated by Image J software.

Quantitative real-time PCR (qRT-PCR) analysis

qRT-PCR analysis was used to analyze the mRNA levels of TGF-β1, Smad3, Smad7, and MMP2. Total RNA was extracted from ovarian tissues using Trizol reagent (Servicebio Biotechnology Co., Ltd., Wuhan, China). RNA concentration and purity were measured with a nucleic acid protein detector (Applied Biosystems, Carlsbad, USA). Subsequently, RNA (1μl) was reversely transcribed into cDNA according to the instructions of Reverse Transcription Kit (Thermo Fisher Scientific, Waltham, USA). PCR reactions were performed with 12.5 μL SYBR Premix (2x), 5 μL of PCR reverse primer, 5 μL of PCR reverse primer, 1.5 μL of cDNA and 1 μL ddH2O. The primer sequences of the target genes were compounded by Servicebio Biotechnology Co., Ltd and were presented as follows: TGF-β1 forward, 5'-CAACAATTCCTGGCGTTACCT-3' and reverse, 5'-GCCCTGTATTCCGTCTCCTT-3'; Smad3 forward, 5'- GGAATGCAGCCGTGGAACTT-3' and reverse, 5'-TTGCAGCCTGGTGGGATCTT-3'; Smad7 forward, 5'-CTCCTCCTTACTCCAGATACCCAA-3' and reverse 5'-TCTCCTCCCAGTATGCCACCA-3'; MMP2 forward, 5'- ACACCAAGAACTTCCGACTATCC -3' and reverse, 5'- GAGCAATGCCATCAAAGACAA-3'; GAPDH forward, 5'-TCTCTGCTCCTCCCTGTTC-3' and reverse, 5'-ACACCGACCTTCACCATCT-3'. The expressions of the target genes were normalized to GAPDH gene employing the 2^−ΔΔCT method.

Western blotting

Total ovarian proteins were extracted by using RIPA lysis buffer containing protease inhibitors and protein phosphatase inhibitors (Servicebio Biotechnology Co., Ltd., Wuhan, China). The mixtures were homogenized and stored on ice for 10min, and then centrifuged at 12,000 rpm for 10 min at 4° C. The supernatant was used to conduct western blot analysis. The proteins (30 μg) were separated with 10% SDS-polyacrylamide gels and then transferred onto PVDF membranes (Millipore, Burlington, USA). After being blocked with 5% skimmed milk for 1 h, the strips of target proteins and internal protein were washed with TBST. The strips were each incubated with primary antibodies against TGF-β1, p-Smad3, Smad3, Smad7, MMP2, and GAPDH purchased from Servicebio Biotechnology Company (Wuhan, China) overnight at 4° C. The strips were then incubated with HRP-conjugated anti-rabbit IgG (CST, Danvers, USA) secondary antibodies for 2h at room temperature. The contents of target proteins were detected with an enhanced chemiluminescence agent (Tanon, Shanghai, China). The grey values of the protein strips were analyzed with Image J software (National Institutes of Health, Bethesda, USA). The expressions of target proteins were normalized to the protein of GAPDH.

Statistical analysis

The measurement data were all expressed as the means ± standard error and analyzed with SPSS 22.0 statistical software. Multi-group comparisons were conducted using ANOVA followed by Dunnett post hoc test at the 0.05 level. KruskalWallis test was used when variables did not meet a normal distribution or homogeneity of variance. P <0.05 was considered as statistically significant.