This article has been corrected: The authors updated the text of the Quantitative real-time PCR section with the sequences of the real-time PCR primers.
Corrected Materials and methods section is presented below.
Quantitative real-time PCR
Real-time PCR was performed on fresh frozen samples. Total RNA was isolated from tissues using the TRIzol reagent (Thermo Fisher Scientific). Then, according to standard methods, qRTPCR analysis was performed to observe the expression level of ZSCAN20. Primers for ZSCAN20 from 5’ to 3’: TGGCCTGGTCAATGTTGAGT (F), TGCACACCTGCAATACGACT (R). Primers for β-actin from 5’ to 3’: TGGAACGGTGAAGGTGACAG (F), AACAACGCATCTCATATTTGGAA (R).



