Expression of αA-crystallin (CRYAA) in vivo and in vitro models of age-related cataract and the effect of its silencing on HLEB3 cells

H₂O₂ promoted cell apoptosis and arrested cell cycle in HLEB3

Based on the apoptosis results of 0 and 500μmol/L H₂O₂ for 12, 24, and 36 hours (Table 1 and Figure 1A, 1B), the apoptosis rate of HLEB3 cells in the 500μmol/L H₂O₂ group significantly over time compared to the 0μmol/L H₂O₂ group. These findings suggest that hydrogen peroxide promotes HLEB3 cells to undergo apoptosis, with the rate of apoptosis increasing the most at 24 hours. The statistical analysis showed that the results were significant across all three time periods.

Figure 1. Effect of H₂O₂ on apoptosis and cycle of HLEB3. (A) a, b, and c are the 0μmol/L H₂O₂ group apoptotic diagrams at 12, 24, and 36 hours, and d, e, and f are the 500μmol/L H₂O₂ group apoptotic diagrams at 12, 24, and 36 h, respectively. (B) The statistical result of apoptosis in each group. (C) h, i and j are the 12, 24 and 36h cycle diagrams of the 0μmol/L H₂O₂ group, and k, l and m are the 12, 24 and 36 h cycle diagrams of the 500μmol/L H₂O₂ group, respectively. (D–F) The statistical results of each period. ns p>0.05, **p<0.01, ***p<0.001, ****p<0.0001.

The G2/M phase of the 500μmol/L H₂O₂ group was higher compared to the 0μmol/L H₂O₂ group at all three time points, indicating that hydrogen peroxide could arrest the cell cycle of HLEB3 cells in G2/M phase. The cell cycle results of 0 and 500μmol/L H₂O₂ at 12, 24 and 36 hours are presented in Table 2 and Figure 1C–1F. The S phase of the HLEB3 cycle grew dramatically and was arrested in the H₂O₂ group at 24 hours, showing that 500μmol/L H₂O₂ had the most pronounced effect on cell cycle arrest at that time.

H₂O₂ reduced the expression of CRYAA in HLEB3

Compared with the normal group, the results of CRYAA mRNA and protein expression in cells treated with 300, 500, and 700μmol/L H₂O₂ for 24 hours are respectively shown in Figure 2E (p value: 0.0233, <0.0001, <0.0001) and Figure 2A, 2B (p values: 0.328, 0.0005, 0.0001). Both mRNA and protein expression levels decreased. After intervention with 0 and 500μmol/L H₂O₂ for 12, 24, and 36 hours, the expression levels of CRYAA mRNA (Figure 2F (p values: 0.0005, <0.0001, <0.0001)) and CRYAA protein (Figure 2C, 2D (p values: 0.0046, 0.0182, 0.0452)) of 500μmol/L H₂O₂ group all decreased compared with the normal group. The results showed an overall decrease in the expression of the CRYAA mRNA and protein expression in HLEB3 cells after H₂O₂ treatment.

Figure 2. CRYAA expression in vivo experiments. (A, B) The expression of CRYAA protein in HLEB3 cells treated with 0, 300, 500, 700μmol/L H₂O₂ for 24 hours and (C, D) 0, 500μmol/L H₂O₂ for 12, 24, 36 hours. (E) The expression of CRYAA mRNA in HLEB3 cells treated with 0, 300, 500, 700μmol/L H₂O₂ for 24 hours; (F) CRYAA mRNA expression in HLEB3 cells treated with 0 and 500μmol/L H₂O₂ for 12, 24, and 36 hours. ns p>0.05, *p<0.05, **p<0.01, ***p<0.001.

Modeling and material extraction

Following naphthalene treatment, slit-lamp examinations were performed to evaluate the condition of the rabbits’ lenses. Within three weeks, small vesicles began to emerge around the lenses, prompting the cessation of the naphthalene treatment and the resumption of a normal diet. Subsequent slit-lamp observations were conducted every 3-4 days to monitor the progression of cataract formation, with corresponding images and timestamps recorded according to the grading standard illustrated in Figure 3A. Additional information, including the development time and grading criteria, is presented in Table 3 [16].

Figure 3. Experimental results of influence of naphthalene on rabbit lens. (A) Slit-lamp images of all grades of rabbit cataract; (B) The normal group (a) and model group (b, c) of rabbit lens HE staining (400x); (C) Statistical results of protein thermal stability experiment; (D) The picture of protein supernatant at 86° C; (E) Expression of CRYAA mRNA in rabbit lenses, **p<0.01; (F) Expression of CRYAA protein in rabbit lenses, *p<0.05; (G) The result of WB banding of CRYAA in rabbit lenses.

Lens structure and protein thermal stability are disrupted

The HE staining results presented in Figure 3B revealed significant disruptions to the lens structure and cellular organization in the model group, as compared to the normal group. Specifically, the normal group (3B-a) exhibited neatly arranged, single-layered lens epithelial cells with clear nuclear structure, as well as well-organized and regular fiber cells. In contrast, the model group (3B-b) showed no clear monolayer epithelial cell structure, with multi-layered nuclear structure and nuclei appeared in the fiber cell area. Moreover, there was no discernible fiber cell structure in this group, and the fiber cell structure was disrupted with vacuoles. In areas without vacuoles, the model group (3B-c) had a single-layered lens epithelial cell structure, although part of the nuclear structure was unclear, and the structure of the fiber cells was irregular and disordered. Additionally, nuclei were present in the fiber cell area in this group as well.

The findings revealed that whereas the OD value of the normal group continuously increased from 37° C to 86° C, the cataract group’s supernatant became increasingly cloudy at a faster rate than the normal group from 62° C to 86° C, and the trend became more pronounced as the temperature rose (Figure 3C). The supernatant of the protein at 86° C is shown in Figure 3D.

CRYAA expression was decreased in rabbit lens

According to the PCR results (Figure 3E) and Western Blotting results (Figure 3F, 3G), the lens of cataract group had lower expression levels of the CRYAA mRNA (p value: 0.0031) and protein expression (p value: 0.0117) compared to the normal group.

Selection of plasmids

Based on the results of cell and animal experiments, we have found that the expression of CRYAA is decreased in the ARC models. This suggests that the decrease of CRYAA may be related to ARC. Therefore, we decided to silence CRYAA in HLEB3 cells to investigate its effect on cell physiological functions. To do this, we transfected three plasmids in to cells for 24, 48, and 72 hours using Lipo3000 transfection reagent and took pictures. The results are shown in Figure 4A. We found that the fluorescence of the transfected cells was strongest at 48 h, and the cells appeared to be in good condition.

Figure 4. Plasmid transfection efficiency and detection of its activity. (A) Fluorescence of plasmid transfection at 24,48,72 h; (B) 48 hours sh260 CRYAA expression amount compared with the normal group, with statistical significance, * p<0.05. (C) Cell activity at three time periods 24, 48, and 72 after transfection, OD value of sh260 group compared with the normal group, with statistical significance, ** p<0.05, * p<0.05. There was no difference between ser and con group.

PCR was then performed 48 hours after cells transfection to measure CRYAA content, and sh260 showed the best silencing efficiency among the three experiments (Figure 4B, p value: 0.0277), thus we selected it for further experiments. Additionally, CCK8 assays were conducted at 24, 48 and 72 hours after cells transfection, which showed a relative reduction in cell activity in the sh260 group (Figure 4C, p value: 0.0041, 0.0127, 0.0126) compared to the control group.

Silencing of CRYAA promoted cell apoptosis and autophagy

Based on the flow cytometry data, we found that silencing CRYAA had no effect cell cycle of HLEB3 cells (Figure 5B, 5b). However, it did promote cell apoptosis (Figure 5A, 5a) compared with the normal group, with statistical significance (p value: 0.0019) in the sh260 group. Additionally, depletion of CRYAA was further confirmed to promote cell apoptosis through the detection the apoptotic proteins CASP 3 and BAX (Figure 5C, 5c, 5d (p value: 0.0031, 0.0114)). Furthermore, the increase of Beclin1, the increase of LC3II/LC3I ratio and the decrease of P62 indicated that depletion of CRYAA promoted autophagy (Figure 5C, 5e, 5f, 5g (p value: 0.0059, 0.0022, 0.0009)).

Figure 5. Effect of CRYAA silencing on apoptosis and autophagy. (A, a) Flow cytometry results of apoptosis at 48 h after transfection, sh260 group compared with the normal group, with statistical significance, ** p<0.01; (B, b) CRYAA silencing had no effect on the cell cycle. (C) WB results for apoptosis and autophagy proteins, c and d are the result of the apoptotic proteins Cas3 and Bax, sh260 group compared with the normal group, with statistical significance, ** p<0.01, * p<0.05. e and g are the result of the autophagy proteins Beclin1and P62, f is the result of LC3II/LC3I, sh260 group compared with the normal group, with statistical significance, *** p<0.01, ** p<0.01. There was no difference between ser and con group.

Experimental methods and animals

New Zealand white rabbits (six-month-old, half male and half female), purchased from the Animal Experimental Center of Ningxia Medical University. The rabbits were kept in a normal laboratory environment with a 12-hour light and dark cycle. The diet was provided by the laboratory. Before experiment, their eyes were examined with a slit lamp (Suzhou Kangjie, CHN) to check for ophthalmic diseases and lens opacity. Rabbits with normal lenses were screened. Ten rabbits were randomly assigned to each group, with half being male and half being female.

Establishment of cataract rabbit model

On the basis of the artificial model method [2, 6], 30g naphthalene (Cas:91-20-3, Shanghai Guangnuo, CHN) was dissolved in 100ml of Tween-80 (Cas:9005-65-6, Tianjin Hengxing, CHN) solution, and a 30% suspension was prepared. The suspension was sonicated in a water-bath ultrasonic pan for 1 hour to ensure the naphthalene to dissolved completely in Tween-80. After allowing the naphthalene to settle and precipitate, the ultrasound was repeated 2-3 times. After standing, naphthalene precipitates into a fine powder (ensure that it does not block the feeding tube).

The rabbits in the model group were administered naphthalene at 0.8 g/kg/day by intragastric administration. Initially, they were given the treatment every 3 days and allowed 1 day of rest. This continued for 1 week. On the other hand, the rabbits in the control group were treated with the same volume of Tween-80. The rabbits were treated with mydriasis (compound tropicamide), and the lens was observed by a slit lamp every 3-4 days, dilate the pupil with Tropicamide Phenylephrine Eye Drops (J20180051, Santen Pharmaceutical, CHN). When cataracts occurred in the model group, naphthalene administration was discontinued, and rabbits without cataracts were excluded from further analysis. When all remains rabbits in the model group reached IV-V cataract, the rabbits were sacrificed after air embolism in the ear vein, and the lens was removed.

Hematoxylin and eosin staining (HE)

The lens tissues were fixed in a 4% paraformaldehyde solution (D16013, Shangbao, CHN), then removed, dehydrated using a gradient concentration of alcohol, and immersed in xylene. They were then embedded in wax, then sectioned, glued, deparaffinized, alcoholized, and stained with hematoxylin and eosin. Finally, the lens tissues were observed and photographed under a microscope.

Cell cultural and plasmid transfection

HLEB3 cells (BNCC 30494, Beijing Beina Chuanglian Institute of Biotechnology.) were removed from the liquid nitrogen tank, resuscitated with medium (containing 89% MEM medium, 10% FBS and 1% double antibody), and cultured to an incubator (culture condition: 37° C, 5% CO₂). The medium was changed every 2-3 days, and the cells were passaged when their density reached 80-90%.

shRNA fragments of CRYAA included shRNA-260, shRNA-261, shRNA-262 and negative control (ser), were obtained from RiboBio, CHN, which can Silence the expression of CRYAA. HLEB3 cells were inoculated into 6-well plates. 24 h later, according to the transfection instructions, the cell medium was replaced with the medium containing Lipofectamine 3000 (L3000008, Invitrogen, USA) transfection reagent, corresponding shRNA and MEM, and 6 h after transfection, the medium was replaced with the complete medium. Fluorescence was taken at 24, 48 and 72 hours by cytation5 (Biotek, USA).

The cell counting Kit-8 (CCK8) method detected cell viability

The cells were divided into three groups: normal group, negative control group and plasmid transfection group. Each group contained 10,000 cells per well, and the cells were seeded into 96-well plates. Cell activity was detected using the CCK8 assay for 24, 48 and 72 hours, respectively.

Cell apoptosis and cell cycle were detected by flow cytometry

The HLEB3 cells were seeded at a density of 2×10⁵ cells/well in 6-well plates. After allowing the cells to adhere and grow to 70-80% confluency, two groups were established: a “normal group” with no treatment, and a “model group” treated with 500μmol/L hydrogen peroxide (30%, Cas:7722-84-1, Yantai Shuangshuang, CHN) for X hours. Then cells assayed at 12, 24, and 36 hours by BD AccuriTM C6 Software (Becton, Dickinson and Company, USA). Annexin V-FITC/PI apoptosis detection kit (KGA107, KeyGEN, CHN); Cell cycle detection kit (KGA512, KeyGEN, CHN).

The selected plasmids were transfected into cells for apoptosis (Annexin V-APC/7-AAD Apoptosis Detection Kit, KGA1025, KeyGEN, CHN) and cell cycle analysis by CytoFLEX S (Beckman Coulter, Inc. USA).

Real-time fluorescence quantitative polymerase chain reaction (PCR)

The following cells or tissues were selected for CRYAA mRNA content detection: A. The HLEB3 cells were treated with 0, 500μmol/L hydrogen peroxide for 12, 24, 36 hours; B. The HLEB3 cells were treated with 0, 300, 500, 700μmol/L hydrogen peroxide for 24 hours; C. Normal rabbit lens and cataract rabbit lens; D. The transfected cells 48 hours which with good fluorescence intensity was selected to screen out the shRNA with the best transfection efficiency. Using RNA extraction reagent trizol (ThermoFisher, USA) extracted total RNA from cells and tissues, TB Green^® Premix Ex Taq^™ II (Tli RNaseH Plus) (RR820A, Takara, JPN) and PrimeScript^™ RT reagent Kit with gDNA Eraser (Perfect Real Time) (RR047A, Takara, JPN) were then used for follow-up experiments. PCR was performed on Fluorescence quantitative PCR instrument (StepOne Software V2.3, ThermoFisher, USA) for 40 cycles, and the CRYAA mRNA expression was analyzed by the 2^-ΔΔCт method. The sequence of primers: human CRYAA (Forward 5’- TCCAGCACCCCTGGTTCAAG -3’, Reverse 5’- CTTGTCCCGGTCGGATCGAA -3’), human GAPDH (Forward 5’- ACACCATGGGGAAGGTGAAG -3’, Reverse 5’ –TAGGGGTCATTGATGGCAAC -3’); rabbit CRYAA (Forward 5’-GGACAAGTTCGTCATCTTCCTGGAC-3’, Reverse 5’-TGTAGCCGTGGTCATCCTGTCTC-3’), rabbit β-actin (Forward 5’-GTGGCATCCTGACGCTCAAGTAC-3’, Reverse 5’- AAGCTCGTTGTAGAAGGTGTGGTG-3’).

Western blotting (WB)

The following cells or tissues were selected for CRYAA protein content detection: A. HLEB3 cells were treated with 0, 500μmol/L hydrogen peroxide for 12, 24, 36 hours; B. HLEB3 cells were treated with 0, 300, 500, 700μmol/L hydrogen peroxide for 24 hours; C: Normal rabbit lens and cataract rabbit lens; D. The cells that were transfected with plasmids were selected. The expression levels of BAX, CASPASE3, P62, Beclin1, LC3 were measured in plasmid transfected cells. Total protein was extracted from cells or tissues by the Whole protein extraction kit (KGP2100, KeyGEN, CHN), and the protein concentration was determined using the BCA kit (ZJ102, Epizyme, CHN). The samples were loaded at 40μg protein per lane for polyacrylamide gel electrophoresis and the membrane transfer. After the membranes were closed using 5% skim milk at room temperature for 2 hours, the primary antibodies were added and incubated at 4° C overnight. After washing the membranes, the secondary antibodies were added and incubated at room temperature for 2 hours. Electrophoresis apparatus (Bio-Rad, USA); Ultra-sensitive multi-function Imager (Amersham Imager 680RGB, USA); Protein ladder (No.PR1910, ThermoFisher, USA); measured gray value: Image J 1.48V(Wayne Rasband, National Institutes of Health, USA).

Antibodies: CRYAA antibody (DF8933, Affinity, USA); GAPDH (ab8245, Abcam, USA); β-actin (AF7018, Affinity, USA); Goat anti-rabbit (S0001, Affinity, USA); Goat anti-Mouse (S0002, Affinity, US); BAX (60267-1-Ig, Wuhan Sanying, CHN), CASPASE3 (ab13847, Abcam, US); P62 (ab56416, Abcam, US); BECN1(ab62557, Abcam, USA); LC3 (ab221794, Abcam, USA); β-tublin (T0023, Affinity, USA).

Protein thermostability assay

An appropriate amount of normal and cataract rabbit lens tissue was added to 1ml of protein lysate (10μL PMSF per 1mL RIPA was added to make the final concentration of PMSF 1mM, PMSF was added on the spot). The sample was homogenized using a frozen grinder and then centrifuged at 12000g for 5 minutes at 4° C. The supernatant was then diluted, and protein concentration was determined at 560nm using BCA method, and the protein supernatant of each group was adjusted to the same concentration (5μg/μL). The same concentration of crystallin supernatant (100μL/ well) was added into the 96-well plate, and the constant temperature incubator was preheated to 37° C. The absorbance value was measured at 320 nm wavelength 37° C, with double distilled water used as reference. The absorbance value at the wavelength of 320nm was measured once every 6° C rise from 50° C for 3 minutes until the temperature reached 86° C.

Statistical analyses

The data were expressed as numbers or percentage or mean ± standard error. One-way analysis of variance was used in dates of three or four groups, and t-test was used in dates of two groups. All data were analyzed using GraphPad Prism 8.2.0 (GraphPad software Inc., San Diego, California, USA). p < 0.05 was of statistical significance.

Data availability

All of the data is available from the corresponding author upon reasonable request.