Introduction
The tsRNAs (tRNA-derived small RNAs) are a novel class of small non-coding RNA derived from transfer-RNA (tRNA), and also called as tRNA-derived fragments (tRFs) [1]. The tRNA fragments are produced through cleavage of mature or pre-mature tRNAs at various positions, the fragments are short and range in length from 16 to 35 nucleotides [2]. A general classification of tsRNAs is based on their position in relation to the parental tRNA sequence, which can be classified into some distinct categories, including 5′-tRFs, 3′-tRFs, and internal tRFs, these tsRNAs originate precisely from the span of mature tRNAs [2, 3]. Two remaining tsRNAs: 5′U-tRFs, which derived from the 5′-leader sequence of primary tRNA genes; and tRF-1 that comprise part of the 3′-trailer sequence [2]. Numerous researches suggested that the generation of tRNAs into specific small fragments was a regimented process, did not result from degradation [4]. These cleavages of tRNAs are context-dependent, including sex, ethnicity, disease, and tissue type of individuals. These dependencies increase the urgency of understanding the regulatory roles of tsRNAs, such efforts are gaining momentum, and comprise experimental and computational approaches [5, 6].
These efforts have discriminated more than thousands of microRNA isoforms via analysis of datasets in The Cancer Genome Atlas (TCGA) [7, 8]. It is worth mentioning that tsRNA is sequenced at an abundance comparable to that of the abundant miRNA [9]. Several studies have linked the tsRNAs to different human cancers, including glioma [10], liver [11] and breast cancer, etc. [12]. Growing evidences demonstrated that many tsRNAs were differentially expressed in the tissues of multiple tumor patients, these dysregulated tRNA fragments might contribute to various biology processes of cancer development and progression [13]. Colon adenocarcinoma (COAD) is the most common type of primary tumor originating in the intestinal tract [14], colon adenocarcinomas may be the higher mortality among gastrointestinal tumors based on epidemiological statistical reports [15]. The pathogenesis of colon adenocarcinomas is extremely complicated, as it involves the aberrant activation of proto-oncogenes and inactivation of anti-oncogenes [14, 16]. However, it is not clear whether the tsRNAs would serve as novel molecular biomarkers for diagnosis, prognosis and target therapy of colon adenocarcinomas.
In the present study, we aimed to identify the tsRNAs profiles within the sncRNA-seq data of human colon adenocarcinomas samples via a deterministic and exhaustive tsRNAs mining pipeline, then investigate the expression patterns and biology function of tRFdb-3013a and tRFdb-3013b in colon adenocarcinomas. Additionally, the relationships between tRFdb-3013a/b and its target genes are also studied in order to reveal the underlying mechanisms.
Results
The identifications of tsRNAs within colon adenocarcinomas data
Firstly, we collected more than thousands of tsRNA signatures from tRFdb [9] and tRFexplorer databases, the tsRNA sequences have mapped within the specific regions of tRNA (transfer-RNA) as described previously [17]. As statistical analysis, these tsRNA fragments are mainly derived from 5′ end (5’-tRFs) and 3′ end of mature tRNA, as well as the 5′ leader (5′U-tRF) and 3′ trailer regions of primary tRNA-gene. With computational approaches, we determined two hundreds of tsRNAs and assessed their expression profiles within the sncRNA-seq data of TCGA-COAD, the summary of our identification pipeline was showed in Supplementary Figure 1A. After filtering, a total of 192 tsRNAs with available expression abundances were identified within COAD samples (Supplementary Table 3), of which about thirty-two percents were derived from the 3′ trailer regions (tRF-1s) of primary tRNA genes, and thirty percent tsRNAs from the 3′ end (3’-tRFs) of mature tRNAs (Supplementary Figure 1C). As for the chromosomes, more than thirty-five percent of tsRNAs are originated from the human chr1 region, and nearly twenty percent originated from the chr6 region (Supplementary Figure 1B).
Based on the differential expression analysis between paired colon adenocarcinoma samples and non-tumor controls, we discriminated a total of forty-two differentially expressed tsRNA-genes (DEGs), of which fifteen were down-regulated and twenty-seven were up-regulated (Figure 1A and Supplementary Table 4) in paired colon adenocarcinomas compared to non-tumor controls. Hierarchical cluster analysis and heatmap of differentially expressed tsRNA genes were performed and exhibited in Figure 1B. The expression patterns of tsRNAs were significantly distinguished between paired colon adenocarcinomas and non-tumor groups. As shown in the blue dotted line frame of Figure 1B, several tsRNAs (including ts-43, ts-44, tRFdb-3013a and tRFdb-3013b) caught our attention that derived from tRNA-His-GUG, which is a histidyl-transfer-RNA [18].

Figure 1. Differential expression analysis between paired colon adenocarcinomas (n=16) and non-tumor controls (n=9) of TCGA-COAD dataset. (A) Volcano plots of the differentially expressed tsRNAs, including 15 up-regulated and 27 down-regulated tsRNAs. (B) Hierarchical clustering and heatmap of differentially expressed tsRNAs, the up-regulated tsRNAs are clustered in red-shaded areas, and the green-shaded areas indicate down-regulation.
Significance of tRFdb-3013a and tRFdb-3013b within colon adenocarcinomas
As shown in Figure 2A, we have identified seven tsRNA fragments derived from tRNA-His-GUG or tRNA-His-GTG gene in the sncRNA-seq datasets of colon adenocarcinomas, there are two 3’-tRFs fragments (tRFdb-3013a and tRFdb-3013b) that can re-map to the cleavages of 3′ end of several different mature tRNA-His-GUG isoforms (Supplementary Figure 2A), and five tRF-1 fragments (ts-30, ts-43, ts-44, ts-1 and ts-88) that can re-map to the down-stream regions (35 bases) of primary tRNA-His-GTG genes. To reveal the implication of these tsRNAs in colon adenocarcinomas, the expression patterns of above tsRNAs were analyzed in the samples of TCGA-COAD dataset. It showed that the expressions of four tsRNAs were down-regulated in colon adenocarcinoma samples compared to paired controls (Supplementary Figure 2B, all P <0.05, Supplementary Table 5), and compared with non-tumor controls, the expressions of tRFdb-3013a and tRFdb-3013b (known simply as tRFdb-3013a/b) were significantly down-regulated in colon adenocarcinoma and/or rectum adenocarcinoma samples with four stages (Figure 2B, 2C, all P <0.01). In our clinical tissue samples detections, it also demonstrated that the tRFdb-3013a/b expressions were down-regulated in colon adenocarcinoma compared to non-tumor controls (Supplementary Figure 3A, 3B).

Figure 2. (A) Representative images of the sequence alignments between tsRNAs and its tRNA sources. (B) The scatter plus box plots of tRFdb-3013a and tRFdb-3013b expression (log2TPM) between non-tumor controls and colon adenocarcinomas (COAD) with four stages (both P <0.01). (C) The scatter plus box plots of tRFdb-3013a and tRFdb-3013b expression (log2TPM) between non-tumor controls and colon plus rectal adenocarcinomas (COAD-READ) with four stages (both P <0.01).
Subsequently, we investigated the relationship between tsRNA expressions and overall survival of colon and/or rectum adenocarcinoma samples using KM (Kaplan–Meier) curve analysis [10]. Based on the median value of tsRNAs expression, primary tumor samples were divided into low-expressions and high-expressions group [19]. As shown in Figure 3B, the clinical survival of colon adenocarcinoma patients with low-expressions of tRFdb-3013a or tRFdb-3013b was worse than that of the high-expression patients (P =0.029 and P =0.026); As for colon adenocarcinoma plus rectum adenocarcinoma (COAD-READ), the clinical survival of patients with low-expressions of tRFdb-3013a or tRFdb-3013b were also significantly worse than that of the high-expression patients (P =0.018 and P =0.011, Figure 3A). What's more, the Cox regression analysis of overall survival within COAD-READ patients were performed [20]. As shown in Figure 4A, the forest plot described that univariate Cox regression analysis of patients showed that low tRFdb-3013a expression (P =0.012), increased age (P <0.001), high AJCC pathologic stage (P <0.01 for stage III and P <0.001 for stage IV), advanced metastasis pathologic spread (P <0.001 for M1) and lymph node pathologic spread (P <0.001 for N2) were the risk factors associated with prognosis. Subsequent multivariate Cox regression analysis results revealed that low tRFdb-3013a expression (HR=1.684, P = 0.006) were an independent prognosis factor for survival of patients (Figure 4B), in addition to the increased age, advanced metastasis and lymph node pathologic spread. Similar results were also obtained from the Cox regression analysis of tRFdb-3013b. These results suggested that down-regulated tRFdb-3013a/b was associated with poor survival prognosis of colon adenocarcinoma and rectum adenocarcinoma patients.

Figure 3. The survival analysis of tRFdb-3013a and tRFdb-3013b. (A) KM curve survival analysis with log-rank tests based on tRFdb-3013a and tRFdb-3013b expression within colon adenocarcinoma plus rectum adenocarcinoma (COAD-READ) samples (n=805) of TCGA datasets. (B) KM survival analysis with log-rank tests based on tRFdb-3013a and tRFdb-3013b expression within colon adenocarcinoma samples (n=587) of TCGA-COAD dataset.

Figure 4. Cox regression analysis of overall survival within colon adenocarcinoma plus rectum adenocarcinoma patients. (A) Univariate analysis of tRFdb-3013a expressions and other risk factors within patients of TCGA dataset. (B) Multivariate Cox regression analysis of tRFdb-3013a expressions and other risk factors within patients.
Nevertheless, does the survival prognosis role of tRFdb-3013a/b specific to colorectal adenocarcinomas, and how about other types of tumors? In order to understand the clinical significances of tRFdb-3013a and tRFdb-3013b within multiple types of tumors, Cox regression analysis with hazard ratio test based on tRFdb-3013a/b expressions were performed within many types of tumors on TCGA datasets. As shown in the left of Figure 5, the forest plot described that tRFdb-3013a and tRFdb-3013b down-regulation were the risk factors associated with prognosis for five types of tumors in TCGA datasets, including COAD, READ, HNSC, KIRC, and LGG (all P≤0.03). Additionally, the differential expression analysis with log2 fold-change test of tRFdb-3013a and tRFdb-3013b were performed between primary tumor samples and paired non-tumor controls. As expected, the bar graphs showed that tRFdb-3013a/b expressions were markedly down-regulated in primary tumor samples compared to non-tumor controls for other six types of tumors (P<0.01, |log(FC)| >1, Figure 5-right). Taken together, the results implicated that only within colon and rectum adenocarcinoma, the expressions of tRFdb-3013a and tRFdb-3013b were both down-regulated, and could be served as the independent risk biomarkers for prognosis.

Figure 5. The clinical significances of tRFdb-3013a and tRFdb-3013b within multiple different types of tumors. (Left) The forest plots of Cox regression analysis with hazard ratio test based on tRFdb-3013a and tRFdb-3013b expressions within many types of tumors on TCGA dataset. (Right) The bar graph of differential expression analysis with a log2 fold-change test of tRFdb-3013a and tRFdb-3013b between primary tumor (TP) samples and non-tumor (NT) controls in multiple types of tumors.
The correlations of tRFdb-3013a/b expression with primary clinical pathological characteristics were analyzed using Chi-square test, and visualized via hierarchical-clustering heatmaps [21]. As shown in Supplementary Figure 4, tRFdb-3013a/b might tend to decreased in the patients with lymphatic or vascular invasion present. However, no significant relationship was found between tRFdb-3013a/b expressions and other pathological characteristics, such as grade, gender, MLH1 silencing, methylation subtype, colon polyps and MSI status, etc. (all P > 0.05). Above all, findings demonstrated that tRFdb-3013a and tRFdb-3013b may serve as novel biomarkers for diagnosis and prognosis of colon adenocarcinomas.
Biological insights of tRFdb-3013a/b on colon adenocarcinoma cells
To further explore the roles of tRFdb-3013a/b on colon adenocarcinomas. The mimic or inhibitor was used to over-expressed or inhibit tRFdb-3013a in cancer cells (Supplementary Figure 5A). Cell proliferations of colon adenocarcinomas were detected using CCK8 assay, it showed that the proliferations were significantly suppressed in cells transfected tRFdb-3013a mimic compared to negative control (NC; both P<0.05; Figure 6A). Transwell and scratch assays were performed to test the effect of tRFdb-3013a on invasion and migration abilities of colon adenocarcinoma cells. The results displayed that migratory rates of cells transfected with tRFdb-3013a mimic were reduced in comparison with negative controls (Figure 6B and Supplementary Figure 5B); the numbers of invasive cells with tRFdb-3013a mimic were significantly reduced, and that cell numbers with tRFdb-3013a inhibitor were increased than those of negative controls (Figure 6C). These suggested that tRFdb-3013a might be effective to regulate the cell proliferations, cell migration and invasion abilities of colon adenocarcinomas.

Figure 6. The roles of tRFdb-3013a on cell proliferations, cell migration and invasion abilities of colon adenocarcinomas. (A) CCK8 assay was performed to measure the cell proliferations of colon adenocarcinoma SW480 cell. (B) Relative gap analysis scratch assays were used to assess the migration ability of SW480 cell. (C) Transwell assays were performed to assess cell invasions of colon adenocarcinomas. ** P < 0.01, * P < 0.05. The “tRF-3013a” means as tRFdb-3013a, the “NC” means as negative control.
Moreover, the enrichment analyses were performed to provide a biological insight concerning the roles of tRFdb-3013a/b, mRNA expression profiling of TCGA-COAD data was used to find the 500-top related-genes of tRFdb-3013a/b via Spearman’s correlation method. As shown in Figure 7A, for gene ontology (GO) analysis [22], some tRFdb-3013a related-genes were enriched in the specific GO terms, such as extracellular matrix organization, collagen-containing extracellular matrix, and extracellular matrix structural constituent (EMILIN1, ADAT2, FBLN1). The dot-plots (Figure 7B) displayed that tRFdb-3013a related-genes were enriched in several KEGG pathway, including phagosome (C1R). In the GSEA analyses [23] (Figure 7C), a molecular signature (LMTK3 target genes) was found to associated with tRFdb-3013a, such as FBLN1 and ILVBL-AS1 were both the tRFdb-3013a related-genes. The enrichment analysis of tRFdb-3013b were also conducted and presented in Supplementary Materials (Supplementary Figure 6). These data suggested that tRFdb-3013a/b might play a critical role in tumor progression of colon adenocarcinomas.

Figure 7. The enrichment analysis of tRFdb-3013a related-genes within TCGA-COAD data. (A) The top gene ontology (GO) terms, including biological process, cellular component and molecular function. (B) The top KEGG pathway for tRFdb-3013a related-genes. The correlation scatter-plots of tRFdb-3013a and its related-genes (ADAT2, EMILIN1, and C1R). (C) GSEA (gene set enrichment analysis) plots of the molecular signatures, the scatter plots for tRFdb-3013a and its related-genes (ILVBL-AS1, FBLN1).
The tRFdb-3013a/b target and regulate ST3GAL1 expression in colon adenocarcinomas
The researches have revealed that tRNA fragments could bind to argonaute (AGO) protein and lead to gene silencing by targeting the 3' untranslated region (3'UTR) of some mRNAs in a manner similar to miRNAs [5, 11]. Via using bioinformatics database and tools [24], many potential targets of tRFdb-3013a/b were predicted and selected out, the interaction relationship of tRFdb-3013a/b and their target genes were presented in Figure 8A.

Figure 8. (A) The interactional network that involved tRFdb-3013a/b and their target genes based on tRFtarget database, the nodes represent target genes, and the lines represent the interaction relationships. (B) The binding sites of tRFdb-3013a/b in the 3’ UTR region of ST3GAL1 based on bioinformatics prediction.
Among these targets, we picked out a molecular with strong binding score, ST3GAL1 gene, which encodes a type II membrane protein with sialyl-transferase activity [25]. The 3′UTR position of ST3GAL1 mRNA contained a putative binding site of tRFdb-3013a/b (Figure 8B and Supplementary Figure 7). Dual-luciferase reporter assays were used to validate their direct targeting affinity, it showed that relative luciferase activity was decreased in the co-transfection of pmirRB-ST3GAL1 wild-type reporter and tRFdb-3013a/b mimic (both P < 0.05, Figure 9B-left), but no significant difference in the mutant reporter. Moreover, the analysis of TCGA-COAD and GSE39582 data showed that ST3GAL1 was highly expressed in colon adenocarcinomas compare to non-tumor controls (Figure 9A, both P <0.01), as mentioned above, tRFdb-3013a and tRFdb-3013b were conversely decreased in colon adenocarcinomas (Figure 2B). In addition, the experiments demonstrated that expression levels of ST3GAL1 mRNA and protein were down-regulated in colon adenocarcinoma cells transfected with tRFdb-3013a/b mimic (both P < 0.01, Figure 9B-right, 9C). These findings indicated tRFdb-3013a and tRFdb-3013b might directly target ST3GAL1 and regulate ST3GAL1 expressions in colon adenocarcinoma cells.

Figure 9. ST3GAL1 was directly regulated by tRFdb-3013a and tRFdb-3013b in colon adenocarcinomas. (A) ST3GAL1 was highly expressed in colon adenocarcinomas compared to non-tumor controls of TCGA-COAD and GSE39582 data (log2TPM, both P <0.01), COAD: colon adenocarcinomas, CRC: colorectal cancers. (B-left) The luciferase reporter assay of colon adenocarcinoma cell co-transfected with pmiR-RB-ST3GAL1 wild-type or mutant report vector, together with tRFdb-3013a/b or NC mimic. (C) Expression levels of ST3GAL1 mRNA (B-right) and protein in colon adenocarcinomas cells transfected with tRFdb-3013a/b mimic or control. ** P < 0.01, * P < 0.05. The “tRF-3013a/b” means as tRFdb-3013a/b, “NC” means as negative control.
Discussion
Identifications and characterizations of tsRNAs are accelerated sharply in the last few years, due in large part to the emergence of next generation sequencing system-level approaches to molecular genetics [5]. In the present study, we firstly identified some tsRNAs within the sncRNA-seq datasets of colon adenocarcinoma samples, most of tsRNAs were derived from the 3′ end of mature tRNA or 3′ trailer regions of primary tRNA genes. Furthermore, a total of forty-two differentially expressed tsRNA genes were discriminated by bioinformatics analysis, of which fifteen were down-regulated and twenty-seven were up-regulated between colon adenocarcinomas and non-tumor controls. In our previous cytobiology study for microRNA, we have noted that it is easy to get the over-expression of microRNA with miRNA mimic, but hard to inhibit or decrease microRNA expression via miRNA inhibitor in vitro. Similarly, for the down-regulated tsRNA, we could make it over-expressed in cells via tsRNA mimic. Therefore, we selected several downregulated tsRNAs for further research. Among them, we picked out seven tsRNAs derived from tRNA-His-GUG, which was a histidyl-transfer-RNA [18]. There were two 3’-tRFs fragments (tRFdb-3013a, whose tDRnamer ID is tDR-60:76-His-GTG-1-M2; and tRFdb-3013b, whose tDRnamer ID is tDR-55:76-His-GTG-1-M2 [26]) can re-map to the cleavage of 3′ end of mature tRNA-His-GUG, the expressions of tRFdb-3013a and tRFdb-3013b were markedly down-regulated in colorectal adenocarcinomas compared to non-tumor controls. KM curve analysis displayed that clinical survival of colon adenocarcinoma patients with low tRFdb-3013a/b expressions were significantly worse than that of the high-expression patients, it suggested that down-regulated tRFdb-3013a and tRFdb-3013b were associated with poor survival prognosis of patients with colon adenocarcinoma and/or rectum adenocarcinoma. In the further analyses of other tumor types from TCGA datasets, however, only within colon adenocarcinoma (COAD) and/or rectum adenocarcinoma (READ), the expressions of tRFdb-3013a and tRFdb-3013b were both down-regulated, and could be served as risk biomarkers for prognosis, not for other type tumors. Further analyses revealed that tRFdb-3013a/b expression might tend to decrease in the patients with lymphatic or vascular invasion present. These findings implied that tRFdb-3013a and tRFdb-3013b might serve as novel biomarkers for diagnosis and prognosis of colorectal adenocarcinomas.
Growing evidences have demonstrated that dysregulated tRNA fragments may contribute to various biological processes of cancer development and progression [13]. For example, Tao et al. have revealed the expression profiles of tsRNAs in human colorectal cancer (CRC) specimens via sequencing analyses, and identified a specific tsRNA derived from the internal of mature histidyl-tRNA, 5'tiRNA-His-GTG (its base sequence is GCCGTGATCGTATAGTGGTTAGTACTCTGCGTTGT), which is up-regulated in CRC tissues [11]. Then, some experiments have revealed that an inhibition of 5'tiRNA-His-GTG suppressed cell proliferations and colony formations, induced cell apoptosis, and affected tumor growth in nude mice, these indicate that 5'tiRNA-His-GTG may act an oncogenic role in the progression of colorectal cancers [11]. In glioma, Ren et al. have determined the differential expressed tsRNAs between tumor tissues with matched non-tumor controls, and found some tRNA-Cys-GCA derived tsRNAs were significantly decreased in tissues from gliomas. Moreover, lower expression of tRNA-Cys-GCA derived tsRNA is associated with poor survival outcome of glioma patients [10]. In present study, certain cyto-biology assays were performed to provide a biological insight concerning the roles of tRFdb-3013a on colon adenocarcinoma cells. It demonstrated that tRFdb-3013a over-expression suppressed cell proliferations, migration and invasion abilities of colon adenocarcinomas in vitro. Moreover, the enrichment analysis showed tRFdb-3013a was associated with specific GO terms, such as extracellular matrix organization, collagen-containing extracellular matrix, and extracellular matrix structural constituent (EMILIN1, ADAT2, FBLN1); the tRFdb-3013a related-genes might refer to phagosome pathway (C1R), as well as the GSEA molecular signature genes (FBLN1 and ILVBL-AS1). These results indicated that down-regulated tRFdb-3013a might act a suppressive role in cell migration and invasion of colon adenocarcinomas via specific signaling pathway.
Though the biological function of tsRNAs is complex and require further elucidation, current knowledge of their function has been a key focus on cancer researches. Previous researches have revealed that tsRNAs could bind to AGO proteins and play a critical role by directly sponging the 3'UTRs of some mRNAs in a manner similar to miRNAs [5]. For example, Goodarzi et al. have identified the new class of tsRNAs derived from several tRNA through hypoxic stress induction, these tsRNAs could bind to the 3'UTRs of YBX1 gene, which encoded an RNA-binding protein, then suppressed the stability of multiple oncogenic transcripts, including EIF4EBP1 and AKT1, results in the tumor-suppressive and metastasis-suppressive activities in breast cancers [12]. Our bioinformatics analyses displayed the interaction relationships of tRFdb-3013a/b and their predicted target genes, and found that tRFdb-3013a/b could bind to the 3’UTR of ST3GAL1, which was highly expressed in colon adenocarcinomas. ST3GAL1 is a membrane protein with sialyl-transferase activity, which has been reported to promote tumor metastasis and invasion by previous study [25]. The luciferase reporter assay showed that tRFdb-3013a/b could directly target 3′UTR of ST3GAL1 and decrease its relative luciferase activity. In addition, tRFdb-3013a over-expressions could down-regulate the expression levels of ST3GAL1 protein and mRNA in colon adenocarcinoma cells. These results suggest tRFdb-3013a and tRFdb-3013b might directly target the 3′UTR of ST3GAL1 and regulate ST3GAL1 expressions in colon adenocarcinomas.
Conclusions
Taken together, our investigation identified the tsRNAs profiles, particularly several tsRNAs derived from tRNA-His-GUG, in the sncRNA-seq data of colon adenocarcinoma samples. Among these, tRFdb-3013a and tRFdb-3013b were significantly down-regulated in colon and rectum adenocarcinomas, the expressions of tRFdb-3013a/b were associated with clinical survival prognosis of colon and rectum adenocarcinoma patients. Over-expression of tRFdb-3013a inhibited cell proliferations, cell migrations and invasions of colon adenocarcinomas. The down-regulated tRFdb-3013a might act an anti-oncogene role in colon adenocarcinomas via specific signaling pathway. Additionally, tRFdb-3013a/b could directly target the 3′UTR of ST3GAL1 and regulate ST3GAL1 expressions in colon adenocarcinomas. These results implied that tRFdb-3013a/b may play an important role in the progression of colon adenocarcinomas, and could be explored as novel biomarkers for diagnosis and prognosis of colon and rectum adenocarcinomas.
Materials and Methods
Bioinformatic analysis
The RNA expression profiles of TCGA datasets were downloaded and processed using TCGAbiolinks package [8]. The differential expression analysis between paired colon adenocarcinoma samples and non-tumor controls was performed with the limma package [33]. An absolute log2 fold-change (|log2FC|) more than one and P-value less than 0.05 were set as cut-off point. Hierarchical clustering of differentially expressed tsRNA genes was performed based on expression values to verify the difference between paired colon adenocarcinomas and non-tumors [19]. Visualization of the tsRNAs including volcano plots and heatmaps was performed with the ggplot2 [34] and pheatmap packages of R, respectively. Survival analysis with Kaplan-Meier (KM) curves plus the log-rank test was performed via the R survival and survminer packages. Hierarchical cluster analysis was performed on tsRNAs expression and primary pathology characteristics, its corresponding heatmap was visualized by pheatmap package (https://cran.r-project.org/web/packages/pheatmap/). Spearman’s correlation was calculated for each pair of tsRNA and mRNA, its scatter diagrams were plotted by ggplot2 and ggpubr package in R software [34]. Some enrichment analyses were performed to provide biology views that regard tRFdb-3013a/b-related genes, the molecular signatures database (MSigDB) was used as gene set for gene set enrichment analysis (GSEA) [23]. Gene ontology, KEGG pathway, and GSEA analysis were visualized by clusterProfiler and enrichplot packages [22, 35]. The computational binding interactions between tsRNA and targets were predicted by tRFtarget databases [24]. The interaction networks of top-50 targets and tRFdb-3013a/b were performed and visualized via Cytoscape (v3.7.2).
Cell culture and transfections
Human colon adenocarcinoma cell lines SW480 and Caco-2 were purchased from the Cell Bank of Chinese Academy of Sciences (Shanghai, China). The cells were cultured in Leibovitz's L-15 medium or Eagle's Minimum Essential Medium (MEM; Servicebio, Wuhan, China) supplemented with 10% or 20% fetal bovine serum (FBS; Servicebio) at 37° C in a humidified incubator with 5 % CO2. The cell lines at 50–70% confluences were transfected with micromolar either mimic for tRFdb-3013a/b (tRF-3013a/b mimic), or inhibitor for tRFdb-3013a (tRF-3013a inhibitor), or negative controls (NC mimic, NC inhibitor) using the Lipofectamine RNAimax reagent (Invitrogen, Thermo Fisher Scientific, USA). The mimic and inhibitor for tRFdb-3013a/b and negative controls were purchased from RiboBio BioTech (Guangzhou, China).
RNA extraction and qRT-PCR analysis
Total RNAs were extracted from cultured cells using the RNAex reagent (AGbio, Changsha, China). One microgram total RNAs of each sample were reversely transcribed into cDNA under standard conditions by using PrimeScript RT reagent Kit with gDNA Eraser (Takara, Shiga, Japan). Quantitative real-time polymerase chain reaction (qRT-PCR) was performed with the SYBR® Premix DimerEraser™ (Takara) on the CFX connect real-time system (Bio-Rad, USA). The Bulge-Loop miRNA qRT-PCR Stater Kit (RiboBio, China) with specific stem-loop RT primers was used to quantify the expression of tsRNAs, following the manufacturer's protocol. RNU6 (U6) was used as the internal control for tsRNAs template normalization, and ACTB (β-actin) for mRNA template normalization. Relative quantification of gene expression was calculated by the comparative cycle-threshold (CT) method [19]. Stem-loop primers for tRFdb-3013a/b, and RNU6 were designed and synthesized by RiboBio BioTech (Guangzhou, China). The general primers for ST3GAL1 and ACTB were designed and synthesized by Sangon Biotech (Shanghai, China), and the primers sequences were listed in Supplementary Table 2.
Protein extraction and Western blot
Total proteins were extracted from cultured cells using RIPA buffer (Beyotime, Shanghai, China) and the protein concentrations were determined using a BCA protein assay kit (Servicebio). The specific primary antibody (anti-ST3GAL1 antibody diluted at 1:1000, Abcam, USA; anti-β-actin antibody diluted at 1:1500, Sigma-Aldrich, USA). The β-actin served as an endogenous protein for normalization. The protein bands were visualized using ChemiScope S6 imaging system and processing software (Clinx, Shanghai, China).
Cell proliferation, migration and invasion assays
Cell proliferation assays were performed with Cell Counting Kit-8 (CCK-8; Selleck, USA), the absorbance (A) in each well was measured at 450 nm with multimode Microplate Reader (Varioskan LUX, Thermo Fisher Scientific). Cell migration and invasion abilities were tested via the scratch and transwell assays, the images of scratch gap and invasion cells were recorded and photographed using Nikon eclipse Ti-S microscope (Tokyo, Japan).
Luciferase reporter assay
The wild-type or mutant sequences of ST3GAL1 3’UTR containing putative tRFdb-3013a and tRFdb-3013b binding sites were subcloned into pmir-RB-Report vector (RiboBio, China). SW480 cells were co-transfected with pmir-RB-Report vector plus or without tRFdb-3013a/b. The luciferase activity was measured using the Dual-luciferase Reporter Assay System (Promega, USA).
Statistical analysis
The statistical analyses were performed with the R software (https://www.r-project.org/), GraphPad Prism version 8.0 (GraphPad Software, Inc., USA) was used for graphing and analysis. Data were exhibited as means ± standard deviation (SD). The Chi-square test was used to compare the categorical variables. Regarding the numerical variables, statistical significance of differences between two groups was assessed using two-sided Student’s t test; and comparisons of multiple groups were made by one-way analysis of variance. All experiments were performed in triplicate and P values less than 0.05 were considered a statistically significant difference.
Data availability statement
The present study used secondary data which are available in the public domain. The dataset has no identifiable information of the survey participants. All data and materials used during the current study are available from the corresponding author on reasonable request. Some limitations about tsRNA identifications were elaborated and described in Supplementary Materials.
Supplementary Materials
Author Contributions
Conception and design: L. Tan and H. Zou; Experiments, data acquisition and analysis: X. Wu, L. Tan, Z. Tang, and H. Zou; Writing, review, and revision of the manuscript: X. Wu, H. Chen, G. Zou, and H. Zou; Study supervision: G. Zou, C. Wen and W. Cao. All authors have contributed significantly and agreed with the content of the final manuscript.
Conflicts of Interest
All authors declare no conflicting interests.
Ethical Statement and Consent
This study was approved by the Ethics Committees of Chongqing Medical University (KJQN202200430). All methods are carried out in accordance with relevant guidelines and regulations. The patients provided written informed consent.
Funding
This work was sponsored by Natural Science Foundation of Chongqing, China (cstc2021jcyj-msxmX0302), and supported by the Science and Technology Research Program of Chongqing Municipal Education Commission (Grant No. KJQN202200430). This work was also supported by grants from the National Natural Science Foundation of China (No. 82003854), and the Program for Youth Innovation in Future Medicine from Chongqing Medical University (W0066). The computing work was partly supported by the Supercomputing Center of Chongqing Medical University.
References
- 1. Kim HK, Fuchs G, Wang S, Wei W, Zhang Y, Park H, Roy-Chaudhuri B, Li P, Xu J, Chu K, Zhang F, Chua MS, So S, et al. A transfer-RNA-derived small RNA regulates ribosome biogenesis. Nature. 2017; 552:57–62. https://doi.org/10.1038/nature25005 [PubMed]
- 2. Shi J, Zhang Y, Zhou T, Chen Q. tsRNAs: The Swiss Army Knife for Translational Regulation. Trends Biochem Sci. 2019; 44:185–9. https://doi.org/10.1016/j.tibs.2018.09.007 [PubMed]
- 3. Schorn AJ, Gutbrod MJ, LeBlanc C, Martienssen R. LTR-Retrotransposon Control by tRNA-Derived Small RNAs. Cell. 2017; 170:61–71.e11. https://doi.org/10.1016/j.cell.2017.06.013 [PubMed]
- 4. Magee R, Rigoutsos I. On the expanding roles of tRNA fragments in modulating cell behavior. Nucleic Acids Res. 2020; 48:9433–48. https://doi.org/10.1093/nar/gkaa657 [PubMed]
- 5. Xie Y, Yao L, Yu X, Ruan Y, Li Z, Guo J. Action mechanisms and research methods of tRNA-derived small RNAs. Signal Transduct Target Ther. 2020; 5:109. https://doi.org/10.1038/s41392-020-00217-4 [PubMed]
- 6. Zou H, Wu LX, Tan L, Shang FF, Zhou HH. Significance of Single-Nucleotide Variants in Long Intergenic Non-protein Coding RNAs. Front Cell Dev Biol. 2020; 8:347. https://doi.org/10.3389/fcell.2020.00347 [PubMed]
- 7. Telonis AG, Magee R, Loher P, Chervoneva I, Londin E, Rigoutsos I. Knowledge about the presence or absence of miRNA isoforms (isomiRs) can successfully discriminate amongst 32 TCGA cancer types. Nucleic Acids Res. 2017; 45:2973–85. https://doi.org/10.1093/nar/gkx082 [PubMed]
- 8. Colaprico A, Silva TC, Olsen C, Garofano L, Cava C, Garolini D, Sabedot TS, Malta TM, Pagnotta SM, Castiglioni I, Ceccarelli M, Bontempi G, Noushmehr H. TCGAbiolinks: an R/Bioconductor package for integrative analysis of TCGA data. Nucleic Acids Res. 2016; 44:e71. https://doi.org/10.1093/nar/gkv1507 [PubMed]
- 9. Kumar P, Mudunuri SB, Anaya J, Dutta A. tRFdb: a database for transfer RNA fragments. Nucleic Acids Res. 2015; 43:D141–5. https://doi.org/10.1093/nar/gku1138 [PubMed]
- 10. Ren J, Wu X, Shang FF, Qi Y, Tang Z, Wen C, Cao W, Cheng Q, Tan L, Chen H, Zhou HH, Zou H. The tRNA-Cys-GCA Derived tsRNAs Suppress Tumor Progression of Gliomas via Regulating VAV2. Dis Markers. 2022; 2022:8708312. https://doi.org/10.1155/2022/8708312 [PubMed]
- 11. Tao EW, Wang HL, Cheng WY, Liu QQ, Chen YX, Gao QY. A specific tRNA half, 5'tiRNA-His-GTG, responds to hypoxia via the HIF1α/ANG axis and promotes colorectal cancer progression by regulating LATS2. J Exp Clin Cancer Res. 2021; 40:67. https://doi.org/10.1186/s13046-021-01836-7 [PubMed]
- 12. Goodarzi H, Liu X, Nguyen HC, Zhang S, Fish L, Tavazoie SF. Endogenous tRNA-Derived Fragments Suppress Breast Cancer Progression via YBX1 Displacement. Cell. 2015; 161:790–802. https://doi.org/10.1016/j.cell.2015.02.053 [PubMed]
- 13. Yu M, Lu B, Zhang J, Ding J, Liu P, Lu Y. tRNA-derived RNA fragments in cancer: current status and future perspectives. J Hematol Oncol. 2020; 13:121. https://doi.org/10.1186/s13045-020-00955-6 [PubMed]
- 14. Bien J, Lin A. A Review of the Diagnosis and Treatment of Metastatic Colorectal Cancer. JAMA. 2021; 325:2404–5. https://doi.org/10.1001/jama.2021.6021 [PubMed]
- 15. Siegel RL, Miller KD, Goding Sauer A, Fedewa SA, Butterly LF, Anderson JC, Cercek A, Smith RA, Jemal A. Colorectal cancer statistics, 2020. CA Cancer J Clin. 2020; 70:145–64. https://doi.org/10.3322/caac.21601 [PubMed]
- 16. Zou H, Wen C, Peng Z, Shao YY, Hu L, Li S, Li C, Zhou HH. P4HB and PDIA3 are associated with tumor progression and therapeutic outcome of diffuse gliomas. Oncol Rep. 2018; 39:501–10. https://doi.org/10.3892/or.2017.6134 [PubMed]
- 17. La Ferlita A, Alaimo S, Veneziano D, Nigita G, Balatti V, Croce CM, Ferro A, Pulvirenti A. Identification of tRNA-derived ncRNAs in TCGA and NCI-60 panel cell lines and development of the public database tRFexplorer. Database (Oxford). 2019; 2019:baz115. https://doi.org/10.1093/database/baz115 [PubMed]
- 18. Veneziano D, Tomasello L, Balatti V, Palamarchuk A, Rassenti LZ, Kipps TJ, Pekarsky Y, Croce CM. Dysregulation of different classes of tRNA fragments in chronic lymphocytic leukemia. Proc Natl Acad Sci USA. 2019; 116:24252–8. https://doi.org/10.1073/pnas.1913695116 [PubMed]
- 19. Xu B, Liang J, Zou H, Wang J, Xiong Y, Pei J. Identification of Novel tRNA-Leu-CAA-Derived tsRNAs for the Diagnosis and Prognosis of Diffuse Gliomas. Cancer Manag Res. 2022; 14:2609–23. https://doi.org/10.2147/CMAR.S367020 [PubMed]
- 20. Zou H, Wu LX, Yang Y, Li S, Mei Y, Liu YB, Zhang L, Cheng Y, Zhou HH. lncRNAs PVT1 and HAR1A are prognosis biomarkers and indicate therapy outcome for diffuse glioma patients. Oncotarget. 2017; 8:78767–80. https://doi.org/10.18632/oncotarget.20226 [PubMed]
- 21. Wickham H. ggplot2: Elegant Graphics for Data Analysis. Cham: Springer International Publishing : Imprint: Springer, pp. 1 online resource (XVI, 260 pages 32 illustrations, 140 illustrations in color. 2016. https://doi.org/10.1007/978-3-319-24277-4
- 22. Wu T, Hu E, Xu S, Chen M, Guo P, Dai Z, Feng T, Zhou L, Tang W, Zhan L, Fu X, Liu S, Bo X, Yu G. clusterProfiler 4.0: A universal enrichment tool for interpreting omics data. Innovation (Camb). 2021; 2:100141. https://doi.org/10.1016/j.xinn.2021.100141 [PubMed]
- 23. Liberzon A, Birger C, Thorvaldsdóttir H, Ghandi M, Mesirov JP, Tamayo P. The Molecular Signatures Database (MSigDB) hallmark gene set collection. Cell Syst. 2015; 1:417–25. https://doi.org/10.1016/j.cels.2015.12.004 [PubMed]
- 24. Li N, Shan N, Lu L, Wang Z. tRFtarget: a database for transfer RNA-derived fragment targets. Nucleic Acids Res. 2021; 49:D254–60. https://doi.org/10.1093/nar/gkaa831 [PubMed]
- 25. Wu X, Zhao J, Ruan Y, Sun L, Xu C, Jiang H. Sialyltransferase ST3GAL1 promotes cell migration, invasion, and TGF-β1-induced EMT and confers paclitaxel resistance in ovarian cancer. Cell Death Dis. 2018; 9:1102. https://doi.org/10.1038/s41419-018-1101-0 [PubMed]
- 26. Holmes AD, Chan PP, Chen Q, Ivanov P, Drouard L, Polacek N, Kay MA, Lowe TM. A standardized ontology for naming tRNA-derived RNAs based on molecular origin. Nat Methods. 2023; 20:627–8. https://doi.org/10.1038/s41592-023-01813-2 [PubMed]
- 27. Chan PP, Lowe TM. GtRNAdb 2.0: an expanded database of transfer RNA genes identified in complete and draft genomes. Nucleic Acids Res. 2016; 44:D184–9. https://doi.org/10.1093/nar/gkv1309 [PubMed]
- 28. Hutter C, Zenklusen JC. The Cancer Genome Atlas: Creating Lasting Value beyond Its Data. Cell. 2018; 173:283–5. https://doi.org/10.1016/j.cell.2018.03.042 [PubMed]
- 29. Barrett T, Wilhite SE, Ledoux P, Evangelista C, Kim IF, Tomashevsky M, Marshall KA, Phillippy KH, Sherman PM, Holko M, Yefanov A, Lee H, Zhang N, et al. NCBI GEO: archive for functional genomics data sets--update. Nucleic Acids Res. 2013; 41:D991–5. https://doi.org/10.1093/nar/gks1193 [PubMed]
- 30. Langmead B, Trapnell C, Pop M, Salzberg SL. Ultrafast and memory-efficient alignment of short DNA sequences to the human genome. Genome Biol. 2009; 10:R25. https://doi.org/10.1186/gb-2009-10-3-r25 [PubMed]
- 31. Anders S, Pyl PT, Huber W. HTSeq--a Python framework to work with high-throughput sequencing data. Bioinformatics. 2015; 31:166–9. https://doi.org/10.1093/bioinformatics/btu638 [PubMed]
- 32. Liao Y, Smyth GK, Shi W. featureCounts: an efficient general purpose program for assigning sequence reads to genomic features. Bioinformatics. 2014; 30:923–30. https://doi.org/10.1093/bioinformatics/btt656 [PubMed]
- 33. Ritchie ME, Phipson B, Wu D, Hu Y, Law CW, Shi W, Smyth GK. limma powers differential expression analyses for RNA-sequencing and microarray studies. Nucleic Acids Res. 2015; 43:e47. https://doi.org/10.1093/nar/gkv007 [PubMed]
- 34. Wickham H. ggplot2: Elegant Graphics for Data Analysis. Use R!,. (Cham: Springer International Publishing: Imprint: Springer). 2016:1. https://doi.org/10.1007/978-3-319-24277-4
- 35. Kanehisa M, Furumichi M, Tanabe M, Sato Y, Morishima K. KEGG: new perspectives on genomes, pathways, diseases and drugs. Nucleic Acids Res. 2017; 45:D353–61. https://doi.org/10.1093/nar/gkw1092 [PubMed]
- 36. Martinho C, Lopez-Gomollon S. Detection of MicroRNAs by Northern Blot. Methods Mol Biol. 2023; 2630:47–66. https://doi.org/10.1007/978-1-0716-2982-6_4 [PubMed]


