Chondrocyte sheet in vivo cartilage regeneration technique using miR-193b-3p to target MMP16

Transfection efficiency and chondrocyte proliferation

Figure 1B and 1C shows that human auricular chondrocytes were successfully transfected with miR-193b-3p; the relative expression of miR-193b-3p/U6 in the experimental group was 434.97 fold (p = 0.0125). Figure 1D shows the proliferation of the chondrocytes cultured in different groups. In the medium supplemented with miR-193b-3p mimics, cell proliferation was superior to the blank control and mimics-NC groups. In addition, cell proliferation in the miR-193b-3p mimics-NC medium was very similar to the blank control group.

In vitro characterizations of chondrocyte sheets

Figure 2A–2C show chondrocytes transfected for 24 hours in different groups. There was no discernible difference among these three groups. Figure 2D–2F show the chondrocyte sheets formed after 8 weeks which could be easily and completely detached from the plate bottom with a pair of tweezers. The cell sheets in the miR-193b-3p group were the thickest and most tenacious; the quality of the cell sheets in the blank control and miR-NC groups was inferior. In the miR-NC group, it was easier to shrink the cell sheet rims while detaching them. These results accorded with SEM detection, which showed an abundance of overlaying cells. Chondrocyte sheets revealed a dense cell network – a mass of ECM secreted by the cells – with tight cell junctions. The surface was wave-like in the miR-193b-3p group (Figure 2I), but smooth in the miR-NC group (Figure 2H), with intermediary results for the blank group (Figure 2G).

In vitro extracellular matrix synthesis of the chondrocyte sheets

H&E staining and immunohistochemical assay (Figure 3) show that chondrocyte quantities and COL2A1 synthesis in the miR-193b-3p were higher than in the other groups. Masson and safranin-O staining (Figure 4) show that chondrocyte quantities and extracellular matrix collagen synthesis were higher in the miR-193b-3p than in the other groups. The histological and immunohistological results in the miR-NC treated group were similar to the blank control group. The larger amounts of chondrocyte proliferation and COL2A1 deposited in the miR-193b-3p group than in the control and miR-NC groups indicated that miR-193b-3p significantly promoted the synthesis of the chondrocyte extracellular matrix.

We also used immunofluorescence staining to detect the COL2A1 deposits of chondrocyte sheets in different groups (Figure 5). Fluorescence microscopy imaging of the nucleus (blue) and COL2A1 (green) was employed. It showed that the expression level of COL2A1 treated with miR-193b-3p was higher than the other two groups, which is consistent with the immunohistochemical results.

In vivo cartilage regeneration of the cell sheets

Eight weeks after subcutaneous transplantation of the cell sheets in nude mice, the implants were analyzed by histological, immunohistochemical and immunofluorescence assays. The gross view clearly revealed that white, glossy neocartilage tissue had formed in vivo in all three groups (Figure 6). Tissue treated with miR-193b-3p appeared to be the thickest (p = 0.0003) and most solid (p = 0.0293) of all three groups.

In the histological examination, chondrocyte sheets developed into mature cartilage tissue with typical lacuna structures. There were many more lacunae in the miR-193b-3p group than in the blank control and miR-NC groups. The immunohistochemical assay also confirmed a strong positive COL2A1 result in the experimental group, which was more deeply stained and contained larger COL2A1 deposits than the other groups (Figure 7). Masson and safranin-O staining (Figure 8) showed that there was deeper stained and higher extracellular matrix collagen synthesis in the miR-193b-3p than in the other groups.

COL2A1 and MMP16 expression of cartilage tissue in vivo in different groups was observed with immunofluorescence assay (Figure 9). Fluorescence microscopy imaging of the nucleus (blue), COL2A1 (green) and MMP16 (red) was employed. Compared with the control and miR-NC groups, the COL2A1 expression in the miR-193b-3p group showed a significant increase and MMP16 expression was the lowest. These results suggested that miR-193b-3p positively impacts synthesis of the auricular chondrocyte extracellular matrix.

Mechanism: effect of miR-193b-3p’s target gene MMP16 on chondrocyte sheets

To gain further insight into the mechanism by which miR-193b-3p regulates the synthesis of chondrocyte ECM, we used the software program TargetScanHuman 7.2 (updated March 2018) to predict the potential targets of miR-193b-3p. Among the candidate target genes, MMP16 (position 2232-2238 of MMP16 3’UTR) (Figure 10A) attracted our attention. We performed luciferase reporter assay to verify whether MMP16 was the target gene of miR-193b-3p. Vectors containing the MMP16 3’UTR seed sequence in the predicted consequential pairing of target region, interacted with miR-193b-3p (Figure 10B). The lower relative luciferase activity in the transfection with MMP16 and miR-193b-3p, compared with the negative control or MMP16 mutant (p = 0.0153) (Figure 10C), supported our hypothesis. In the present study, dual-luciferase reporter assay proved that MMP16 was a target gene of miR-193b-3p.

Subsequently, Figure 10D and 10E show the gene expression of COL2A1 and MMP16 (p < 0.0001 and p = 0.0125 respectively), while Figure 10F shows the protein expression for chondrocytes cultured in different groups. There was a statistically significant increase in both the COL2A1 gene and protein levels and a decrease in MMP16 levels following treatment with miR-193b-3p compared with the control or miR-NC groups (Figure 10G and 10H). The quantitative protein level of MMP16 also demonstrated that miR-193b-3p + MMP16 overexpression was repressed and COL2A1 promoted. Furthermore, quantitative PCR and western blot also demonstrated that miR-193b-3p can inhibit MMP16 expression in our study. All these results confirm that miR-193b-3p can promote synthesis and accumulation of ECM by regulating the expression of target gene MMP16.

In vitro chondrocyte isolation, culture and chondrocyte sheet engineering

All procedures in this research were approved by the Research Ethics Committee of Shanghai Ninth People’s Hospital. Primary chondrocytes were isolated from remnant auricular cartilage of microtia patients (average age = 12.7 ± 4.12 years, male : female ≈ 5:4) undergoing the first stage of ear reconstructive surgery. Cartilage was cut into pieces (1-2mm³) and digested with 2% Type II Collagenase (Sigma-Aldrich, St. Louis, Mo, USA) for 8 hours at 37°C. Following filtration through a 200-mesh filter net and centrifuging, auricular chondrocytes were separated and cultured in a humidified 37°C and 5% CO₂ incubator. The DMEM (Dulbecco's Modified Eagle Medium) (Hyclone, Logan City, UT, USA) medium supplemented with 10% fetal bovine serum (FBS, Gibco, USA), 100 U/ml penicillin and 100 μg/ml streptomycin, was renewed every two days. Chondrocytes cultured to the second passage were used in this study as previously described [33]. Chondrocytes were seeded into 6-well plates with 10×10⁶ cells/well density for 8 weeks. The chondrocytes secreted ECM and gradually formed a chondrocyte sheet, which could be detached easily from the plate bottom with a pair of tweezers.

MicroRNA oligonucleotide transfection and overexpression of MMP16

Self-inactivating lentiviruses (Figure 1A) which express hsa-miR-193b-3p mimics (AACUGGCCCUCAAAGUCCCGCU) and mimics negative control (Mimics-NC) (UUUGUACUACACAAAAGUACUG) miRNAs were purchased from Umibio (Shanghai Co., Ltd., China). After 72 hours, the infection efficiency was detected by immunofluorescence and qPCR (quantitative Polymerase Chain Reaction). MMP16 overexpression plasmids were purchased from RiboBio (Guangzhou Co., Ltd., China). Cells incubated using serum-free DMEM for 24 hours were transfected with plasmids using Lipofectamine 2000 reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. Cells without transfection were used as blank controls.

Evaluation of cell proliferation

Cell proliferation was estimated in 96-well plates using Cell Counting Kit-8 (CCK-8, Dojindo Laboratories, Kumamoto, Japan). The chondrocytes were seeded at 2×10³ cells/well supplemented with miR-193b-3p mimics, mimics-NC or DMEM and measured continuously for ten days. A 10 μl CCK-8 reagent was added to each sample and incubated for one hour in a humidified incubator at 37°C with 5% CO₂; absorbance was then measured at 450 nm by a microplate reader (Thermo Labsystems, Vantaa, Finland). All experiments were performed in triplicate.

Structural observation of the chondrocyte sheets

The cell sheets sized 1cm³ were cleaned three times with PBS (phosphate buffer saline) and fixed with 2.5% glutaraldehyde at 4°C for two hours. After a thorough washing with PBS, the specimens were dehydrated by a gradual concentration change of ethanol and dried by lyophilization. The samples were then coated with platinum and observed by scanning electron microscopy (SEM).

In vivo implantation of the chondrocyte sheets

The in vitro cultured chondrocyte sheets were divided into three groups and implanted subcutaneously into nude mice: 1) miR-193b-3p group: chondrocyte sheet cultured with miR-193b-3p mimics; 2) miR-NC group: chondrocyte sheet cultured with miR-193b-3p mimics negative control; 3) Ctrl group: chondrocyte sheet alone (n = 3 for each group, derived from nine nude mice). The samples were harvested at 8 weeks post-implantation for gross view, histological examination, immunohistochemical analysis and immunofluorescence assay.

Histological and immunohistochemical examinations

The different chondrocyte sheet groups were fixed in 4% paraformaldehyde, dehydrated in a graded ethanol series and then embedded in paraffin. Specimens were stained with Hematoxylin and Eosin (H&E), masson and safranin-O; immunohistological analysis was also carried out. Type II Collagen primary antibodies (rabbit anti human, Servicebio, GB13021, 1:400 dilution) and the secondary antibody (goat anti rabbit, DAKO, K5007, 1:1 dilution) were successively subjected to immunohistological assay. The samples were then observed and photographed under a high-quality microscope.

Immunofluorescence assay

The different groups of chondrocyte sheets were fixed in 4% paraformaldehyde and embedded in paraffin. Cell sheets were incubated with Type II Collagen primary antibodies (rabbit anti human, Servicebio, GB11021, 1:100 dilution), MMP16 (goat anti human, R&D, AF1785, 1:40 dilution) and a secondary antibody (donkey anti rabbit, Servicebio, GB22403, 1:200 dilution and donkey anti goat, Servicebio, GB21404, 1:300 dilution). The cell nuclei were stained with 4′-6-diamidino-2-phenylindole (DAPI, Servicebio, G1012). The samples were then observed and photographed observed under a high-quality fluorescence microscope.

Luciferase assay

The DNA sequences of MMP16 3’UTR were amplified by PCR and the seed sequences mutated. The amplified DNA sequences were inserted into the luciferase vectors (RiboBio Co., Ltd., Guangzhou, China) to generate MMP16 3’UTR wild type (wt) or mutated type (mut). The luciferase activity was measured according to the manufacturer’s instructions. Only vectors without cells were used as blank controls. Luminescence was measured and relative luciferase activity calculated. The samples were assayed in triplicate.

Quantitative real-time polymerase chain reaction (qPCR)

Total RNA for each different group treated with miR-193b-3p mimics, mimics-NC or DMEM was isolated with a Trizol reagent (Life Technologies, Carlsbad, CA, USA) according to the manufacturer’s instructions. Complementary DNA (cDNA) was then synthesized using a PrimeScript 1^st Strand cDNA Synthesis kit (Takara, Japan). Quantitative real-time PCR analysis was performed with the Bio-Rad real-time PCR system (Bio-Rad, USA) on the gene expression of COL2A1, MMP16 and miR-193b-3p (Table 1). The relative gene expression levels were calculated by the 2^−ΔΔCt method. All experiments were performed in triplicate.

Western blot analysis

The protein expression of COL2A1 and MMP16 were examined by western blot analysis. The chondrocytes were treated with miR-193b-3p mimics, mimics-NC, MMP16 expression or DMEM. The specimens were washed twice using PBS and lysed using a RIPA lysis reagent (Thermo Fisher Scientific, Rockford, Illinois, USA). The protein concentrations were determined by bicinchoninic acid (BCA) assay (Pierce Biotechnology, Waltham, Massachusetts, USA). The samples were incubated overnight with primary antibodies including rabbit anti human COL2A1 (Abcam, ab188570, 1:1000 dilution) and goat anti human MMP16 (R&D, AF1785, 1:10000 dilution) at 4°C. The membrane for each antibody was then visualized with horseradish peroxidase (HRP) conjugated secondary antibodies (goat anti-rabbit and donkey anti-goat, Daixuan Bio, 1:500 dilution). The intensities of the protein bands, representative of protein levels, were determined using Quantity One Image software. β-actin was used to normalize target proteins. All experiments were performed in triplicate.

Statistical analysis

All experiments were performed and analyzed in triplicate. The data are presented as the mean ± SD. Statistical analysis was performed using single-factor analysis of variance (ANOVA) and the Tukey test was used to compare significant differences for multiple groups. A value of p < 0.05 was considered to be statistically significant.