Research Paper Volume 13, Issue 18 pp 22315—22331

High CTSL2 expression predicts poor prognosis in patients with lung adenocarcinoma

Junnian Song1, *, , Jindong Jiang2, *, , Na Wei1, , Zongsheng Duan3, , Gang Wang4, , Weiyun Pan5, ,

* Equal contribution

Received: April 10, 2021       Accepted: September 3, 2021       Published: September 23, 2021      

https://doi.org/10.18632/aging.203540

Copyright: © 2021 Song et al. This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 3.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Abstract

Cathepsin like 2 (CTSL2) is a lysosomal cysteine protease, and may be associated with tumor metastasis. However, CTSL2 has not been reported as a biomarker in lung adenocarcinoma (LUAD). In this study, bioinformatics analysis using data from The Cancer Genome Atlas was performed. Wilcoxon rank-sum test and chi-square test were carried out. Kaplan-Meier and Cox regression were performed to evaluate the effect of CTSL2 expression in the overall survival. Our results indicated that CTSL2 in tumor was significantly higher than that in normal tissue (P < 0.001). High CTSL2 expression was significantly associated with age (P = 0.02), vital status (P < 0.001), and T classification (P = 0.03), and correlated with poor overall survival (HR = 1.62, 95% CI = 1.21–2.18, P = 0.001). CTSL2 expression was an independent risk factor for overall survival in patients with LUAD (HR = 1.52, 95% CI = 1.12–2.05, P = 0.006). A nomogram was plotted for illustration of CTSL2 expression on the risk of LUAD. Furthermore, in vitro cell experiments showed the CTSL2 promoted the proliferation and migration of A549 cells. In summary, high CTSL2 expression predicts poor prognosis in patients with LUAD.

Introduction

Lung cancer is malignant with high incidence and mortality all over the world [1, 2]. The 5-year survival rate of lung cancer is 4–17% based on different stages when diagnosed [3]. Lung adenocarcinoma (LUAD) is the most common type of lung cancer in histology [1, 2].

The pathogenesis of LUAD is complicated [4]. In addition to genetic factors, the main risk factors are smoking, asbestos, radon and other environmental factors [5]. Although the targeting and immunotherapy of LUAD have made great progresses in recent years, its prognosis is still poor [6]. The main reason is the polymer heterogeneity of lung cancer [7]. Since the current diagnostic methods relying on low-dose CT scans and classic serum tumor markers are limited and not specific, LUAD is usually at an advanced stage when diagnosed [8, 9]. Therefore, it is greatly significant to carry out more in-depth explorations of LUAD, and to find new biomarkers related to its diagnosis and prognosis.

Metastatic progression is one of the biggest challenges, which limits the effect of cancer therapies. Proteolysis is involved in the invasion by cleavage of proteins that mediate adherence to neighboring cells. Cathepsins are a family of lysosomal proteases involved in proliferation, invasion and metastasis of different kinds of cancers [10]. The human cysteine cathepsin family is comprised of eleven members including Cat B, C, F, H, L, K, O, S, V, W, and X/Z, which shares a conserved active site. CTSL2 gene encodes cathepsin like 2 (cathepsin L2, also known as cathepsin V) [11]. CTSL2 is a lysosomal cysteine protease, and may be associated with tumor metastasis [10, 12]. Overexpression of CTSL2 has been found in various human cancers, including breast cancer, squamous cell carcinoma, thymic carcinoma, et al. [1315]. Besides, CTSL2 is regarded as a potential drug target [16]. These findings indicate that CTSL2 may be a biomarker for cancer diagnosis and prognosis. Therefore, we focus on the role of CTSL2 in LUAD.

In this study, bioinformatics analysis of CTSL2 in LUAD was performed. The association between CTSL2 expression and clinical features in LUAD was studied. CTSL2 expression in the overall survival and on the risk of LUAD was illustrated. Furthermore, in vitro cell experiments of CTSL2 expression on cell proliferation and migration of LUAD cells were carried out. CTSL2 is found to have predictive value, and high CTSL2 expression is in association with poor prognosis of LUAD.

Results

Characteristics of patients with lung cancer

Totally, 517 LUAD patients were involved, including 277 (53.58%) females, and 240 (46.42%) males (Table 1). As for LUAD stage, there were 277 (53.58%) in I, 122 (23.60%) in II, 84 (16.25%) in III, and 26 (5.03%) in IV. Moreover, the T2 (53.77%), N0 (64.41%), and M0 (67.12%) showed the highest percentage. It can be seen that 99.61% were primary lung cancer.

Table 1. Clinical characteristics of the lung adenocarcinoma patients.

CharacteristicsN (%)
Age (years)
 <5571 (13.73)
 > = 55427 (82.59)
 NA19 (3.68)
Gender
 Female277 (53.58)
 Male240 (46.42)
Stage
 I277 (53.58)
 II122 (23.60)
 III84 (16.25)
 IV26 (5.03)
 NA8 (1.55)
T classification
 T1170 (32.88)
 T2278 (53.77)
 T347 (9.09)
 T419 (3.68)
 TX3 (0.58)
N classification
 N0333 (64.41)
 N196 (18.57)
 N274 (14.31)
 N32 (0.39)
 NX11 (2.13)
 NA1 (0.19)
M classification
 M0347 (67.12)
 M125 (4.84)
 MX141 (27.27)
 NA4 (0.77)
Radiation therapy
 No400 (77.37)
 Yes60 (11.61)
 NA57 (11.03)
Residual tumor
 R0345 (66.73)
 R113 (2.51)
 R24 (0.77)
 RX25 (4.84)
 NA130 (25.15)
Vital status
 Deceased187 (36.17)
 Living330 (63.83)
Sample type
 Primary tumor515 (99.61)
 Recurrent tumor2 (0.39)
Abbreviations: NA: not available; X represents uncertain.

High CTSL2 expression in LUAD

The expression of CTSL2 in lung adenocarcinoma and normal lung tissues were compared (Figure 1A). The tumor CTSL2 level was significantly increased (P < 0.001) in comparison with normal tissue. The comparison of tumor and paired normal tissue further verified the high CTSL2 expression in LUAD (P < 0.001; Figure 1B).

CTSL2 expression in lung adenocarcinoma tissues. (A) CTSL2 expression in normal and tumor tissues. (B) CTSL2 expression in paired tissues.

Figure 1. CTSL2 expression in lung adenocarcinoma tissues. (A) CTSL2 expression in normal and tumor tissues. (B) CTSL2 expression in paired tissues.

Correlation between CTSL2 expression and clinical characteristics

As shown in Table 2 and Figure 2, high CTSL2 expression was significantly associated with age (P = 0.02), vital status (P < 0.001), and T classification (P = 0.03). Meanwhile, gender, stage, N and M classification, and residual tumor showed no significant differences.

Table 2. Logistic analysis of the association between CTSL2 expression and clinical characteristics.

CharacteristicsTotalHighLowχ2P
Age<557142 (17.65)29 (11.15)3.7710.052
> = 55427196 (82.35)231 (88.85)
GenderFemale277123 (50.2)154 (56.62)1.8820.170
Male240122 (49.8)118 (43.38)
StageI277123 (50.62)154 (57.89)2.7780.423
II12264 (26.34)58 (21.8)
III8443 (17.7)41 (15.41)
IV2613 (5.35)13 (4.89)
T classificationT117067 (27.35)103 (37.87)11.5030.019
T2278147 (60)131 (48.16)
T34724 (9.8)23 (8.46)
T4197 (2.86)12 (4.41)
TX30 (0)3 (1.1)
N classificationN0333149 (60.82)184 (67.9)10.8930.023
N19655 (22.45)41 (15.13)
N27437 (15.1)37 (13.65)
N322 (0.82)0 (0)
NX112 (0.82)9 (3.32)
M classificationM0347164 (67.21)183 (68.03)0.2100.902
M12513 (5.33)12 (4.46)
MX14167 (27.46)74 (27.51)
Radiation therapyNo400179 (84.83)221 (88.76)1.2220.269
Yes6032 (15.17)28 (11.24)
Residual tumorR0345173 (89.18)172 (89.12)1.7330.677
R1135 (2.58)8 (4.15)
R243 (1.55)1 (0.52)
RX2513 (6.7)12 (6.22)
Vital statusDeceased187107 (43.67)80 (29.41)10.7460.001
Living330138 (56.33)192 (70.59)
Sample typePrimary tumor515243 (99.18)272 (100)0.6140.433
Recurrent tumor22 (0.82)0 (0)
X represents uncertain.
CTSL2 expression of patients with lung adenocarcinoma grouped by (A) age, (B) gender, (C) stage, (D) vital status, (E) T classification, (F) N classification, (G) M classification, and (H) residual tumor.

Figure 2. CTSL2 expression of patients with lung adenocarcinoma grouped by (A) age, (B) gender, (C) stage, (D) vital status, (E) T classification, (F) N classification, (G) M classification, and (H) residual tumor.

High CTSL2 expression is an independent risk factor for overall survival

As shown in Figure 3A, high expression of CTSL2 was associated with poor prognosis (P = 0.0011). The subgroup analysis (Figure 3B3P) showed that high expression of CTSL2 was significantly associated with poor prognosis in stage I (P = 0.025), N0 (P = 0.015), and M0 (P = 0.0065). As shown in Table 3, the high expression of CTSL2 was significantly correlated with poor overall survival (HR = 1.62, 95% CI = 1.21–2.18, P = 0.001). As shown in Table 3 and Figure 4, high CTSL2 expression was confirmed to be an independent risk factor for overall survival (HR = 1.52, 95% CI = 1.12–2.05, P = 0.006).

Kaplan-Meier curve for overall survival in lung adenocarcinoma. (A) CTSL2 in all tumors; (B–G) Subgroup analysis for stage I/II, III/IV, I, II, III, and IV; (H–P) Subgroup analysis for T1, T2, T3, T4, N0, N1, N2, M0, and M1.

Figure 3. Kaplan-Meier curve for overall survival in lung adenocarcinoma. (A) CTSL2 in all tumors; (BG) Subgroup analysis for stage I/II, III/IV, I, II, III, and IV; (HP) Subgroup analysis for T1, T2, T3, T4, N0, N1, N2, M0, and M1.

Table 3. Univariate and multivariate Cox regression analyses of clinical characteristics associated with overall survival.

CharacteristicsUnivariate analysisMultivariate analysis
HR95% CIPHR95% CIP
Age0.820.55–1.220.322
Gender1.050.78–1.400.760
Stage1.681.47–1.93<0.0011.541.24–1.92<0.001
T classification1.521.26–1.82<0.0011.200.99–1.450.064
N classification1.671.41–1.97<0.0011.110.89–1.400.357
M classification1.401.04–1.900.0290.920.67–1.260.611
Radiation therapy1.250.89–1.750.199
Residual tumor1.201.01–1.420.0371.100.92–1.300.310
CTSL2 expression1.621.21–2.180.0011.521.12–2.050.006
Abbreviations: HR: hazard ratio; CI: confidence interval.
Forest plot of the multivariate Cox regression analysis in lung adenocarcinoma.

Figure 4. Forest plot of the multivariate Cox regression analysis in lung adenocarcinoma.

Diagnostic value of CTSL2 for LUAD

The ROC curves were drawn to examine the diagnostic value of for LUAD. The area was 0.881, indicating a modest diagnostic value of CTSL2 expression (Figure 5A). As shown in Figure 5B5E, the AUC values were 0.763 for stage I, 0.827 for stage II, 0.816 for stage III, and 0.771 for stage IV, respectively. Furthermore, a nomogram model was established for predicting the survival probability of LUAD patients in different years, which involved stage and CTSL2 expression (Figure 6). To evaluate the discrimination and performance of the model, DCA, calibration, and ROC curves were plotted, indicating that the nomogram was stable in predicting the prognosis of LUAD patients (Supplementary Figure 1).

Diagnostic value of CTSL2 expression in lung adenocarcinoma. (A) ROC curve for CTSL2 in normal lung tissue and tumor; (B–E) Subgroup analysis for stage I, II, III, and IV.

Figure 5. Diagnostic value of CTSL2 expression in lung adenocarcinoma. (A) ROC curve for CTSL2 in normal lung tissue and tumor; (BE) Subgroup analysis for stage I, II, III, and IV.

Nomogram for predicting probability of patients with 1-, 2- and 3-year overall survival. 1-, 3- and 5-year related survival probabilities were obtained by draw a line straight down to the Risk axis.

Figure 6. Nomogram for predicting probability of patients with 1-, 2- and 3-year overall survival. 1-, 3- and 5-year related survival probabilities were obtained by draw a line straight down to the Risk axis.

CTSL2-related signaling pathways by GSEA

The gene set enrichment analysis (GSEA) was carried out to identify differentially activated signaling pathways in low and high expression of CTSL2. As shown in Table 4, the significant gene sets enriched in the high CTSL2 expression were observed. As shown in Figure 7A7K, different enrichments were observed in cell cycle, basal transcription factors, spliceosome, p53 signaling pathway, oocyte meiosis, mismatch repair, DNA replication, ubiquitin mediated proteolysis, nucleotide excision repair, homologous recombination, and base excision repair.

Table 4. Gene sets enriched in the high CTSL2 expression phenotype.

Gene set nameSizeESNESNOM p-valueFDR q-value
KEGG_CELL_CYCLE118–0.654–1.935<0.0010.103
KEGG_BASAL_TRANSCRIPTION_FACTORS35–0.557–1.909<0.0010.069
KEGG_SPLICEOSOME114–0.522–1.8940.0080.055
KEGG_P53_SIGNALING_PATHWAY67–0.561–1.8290.0020.079
KEGG_OOCYTE_MEIOSIS112–0.499–1.7950.0060.081
KEGG_MISMATCH_REPAIR23–0.714–1.7810.0020.078
KEGG_DNA_REPLICATION36–0.769–1.7700.0020.073
KEGG_UBIQUITIN_MEDIATED_PROTEOLYSIS134–0.323–1.7530.0190.074
KEGG_NUCLEOTIDE_EXCISION_REPAIR44–0.533–1.7240.0220.085
KEGG_HOMOLOGOUS_RECOMBINATION26–0.723–1.6270.0060.146
KEGG_BASE_EXCISION_REPAIR33–0.515–1.5800.0460.161
Abbreviations: ES: enrichment score; NES: normalized enrichment score; NOM: nominal; FDR: false discovery rate.
Enrichment plots from GSEA of (A) cell cycle, (B) basal transcription factors, (C) spliceosome, (D) p53 signaling pathway, (E) oocyte meiosis, (F) mismatch repair, (G) DNA replication, (H) ubiquitin mediated proteolysis, (I) nucleotide excision repair, (J) homologous recombination, and (K) base excision repair in lung adenocarcinoma cases with high CTSL2 expression.

Figure 7. Enrichment plots from GSEA of (A) cell cycle, (B) basal transcription factors, (C) spliceosome, (D) p53 signaling pathway, (E) oocyte meiosis, (F) mismatch repair, (G) DNA replication, (H) ubiquitin mediated proteolysis, (I) nucleotide excision repair, (J) homologous recombination, and (K) base excision repair in lung adenocarcinoma cases with high CTSL2 expression.

Validation using independent external database

Two independent external datasets were used to validate the prognostic value of CTSL2 expression. By analyzing GSE30219, we found patients with high CTSL2 expression showed decreased overall survival (Figure 8A8H). Consistently, decreased overall survival was also observed in patients with high CTSL2 expression by analyzing GSE50081 (Figure 8I8P). Furthermore, 12 distinct LUAD datasets (including Beer Lung, Bhattacharjee Lung, Garber Lung, Hou Lung, Landi Lung, Okayama Lung, Selamat Lung, Stearman Lung, Su Lung, TCGA Lung, Weiss Lung, and Yamagata Lung) indicated the CTSL2 expression was significantly increased by pooled analysis in the Oncomine database (Figure 9A9B) [1727]. Besides, significantly increased CTSL2 expression was observed in the TIMER database (Figure 9C). Of note, high expression of CTSL2 is usually found in different kinds of solid tumors, including lung cancer, cervical carcinoma, cholangiocarcinoma, colorectal cancer, et al.

Kaplan–Meier curve for overall survival in lung adenocarcinoma in the validation datasets GSE30219 (A–H) and GSE50081 (I–P).

Figure 8. Kaplan–Meier curve for overall survival in lung adenocarcinoma in the validation datasets GSE30219 (AH) and GSE50081 (IP).

Expression analysis of CTSL2 by Oncomine and TIMER databases. (A) Expression of CTSL2 in different types of human cancers in the Oncomine database; (B) CTSL2 is over-expression (red) in lung adenocarcinoma by Oncomine meta-analysis comparing with normal tissue; (C) Expression of CTSL2 in different types of human cancers in the TIMER database.

Figure 9. Expression analysis of CTSL2 by Oncomine and TIMER databases. (A) Expression of CTSL2 in different types of human cancers in the Oncomine database; (B) CTSL2 is over-expression (red) in lung adenocarcinoma by Oncomine meta-analysis comparing with normal tissue; (C) Expression of CTSL2 in different types of human cancers in the TIMER database.

High CTSL2 expression in LUAD tissue and cell

As shown in Figure 10A, CTSL2 expression was significantly higher in LUAD than adjacent normal tissue (P < 0.001). Besides, the CTSL2 expression was significantly increased (P < 0.01) in lung cancer cell lines in comparison with normal cell lines (Figure 10B). Notably, A549 cell line showed the highest CTSL2 expression among all the lung cancer cell lines, and used for the subsequent experiments.

CTSL2 expression in human LUAD tissues and cell lines. (A) Expression of CTSL2 in 35 LUAD tissues and adjacent normal tissues by qRT-PCR; (B) CTSL2 expression levels in HaCaT, BEAS-2B, A549, SPCA-1, 95-D, PG-49, and NCI-H292 by qRT-PCR; (C) CTSL2 expression in A549 cells transfected with control, si-NC, si-CTSL2, and O-CTSL2 by qRT-PCR. **P

Figure 10. CTSL2 expression in human LUAD tissues and cell lines. (A) Expression of CTSL2 in 35 LUAD tissues and adjacent normal tissues by qRT-PCR; (B) CTSL2 expression levels in HaCaT, BEAS-2B, A549, SPCA-1, 95-D, PG-49, and NCI-H292 by qRT-PCR; (C) CTSL2 expression in A549 cells transfected with control, si-NC, si-CTSL2, and O-CTSL2 by qRT-PCR. **P < 0.01.

CTSL2 promoted the proliferation and migration of A549 cells

The function of CTSL2 on A549 cell proliferation was studied by transfection of siRNA and non-silencing RNA sequences. As shown in Figure 10C, the qRT-PCR was performed to validate the over-expression and knockdown efficiency. It can be observed that CTSL2 expression was significantly decreased after transfection of si-CTSL2 (P < 0.01), and increased after transfection of O-CTSL2 in A549 cells (P < 0.01).

The role of CTSL2 on proliferation and migration of A549 cells was studied. As shown in Figure 11A, over-expression and knockdown of CTSL2 promoted and inhibited the proliferation of A549 cells, respectively. The results of CCK-8 were verified by the LIVE/DEAD staining (Figure 11B11C). Compared with control and si-NC group, si-CTSL2 group showed significantly higher percentage of dead cells (P < 0.01). The results of colony formation were consistent with those of CCK-8 and LIVE/DEAD staining (Figure 11D11E). Over-expression of CTSL2 showed significantly increased number of colonies (P < 0.05). The cell migration assay showed that si-CTSL2 significantly reduced and O-CTSL2 significantly increased the migration distance of A549 cells (Figure 11F11G).

CTSL2 promoted cell proliferation and migration of LUAD cells. (A) CCK-8 proliferation curve of A549 cells; (B) Co-staining of calcein AM and PI of A549 cells, the live cells were stained with green fluorescence, and the dead cells were stained with red fluorescence; (C) Percentage of dead cells in different groups; (D) Colony formation of A549 cells; (E) Relative number of colonies in different groups; (F) Cell migration of A549 cells during 24 h; (G) Migration distance in different groups. *P **P

Figure 11. CTSL2 promoted cell proliferation and migration of LUAD cells. (A) CCK-8 proliferation curve of A549 cells; (B) Co-staining of calcein AM and PI of A549 cells, the live cells were stained with green fluorescence, and the dead cells were stained with red fluorescence; (C) Percentage of dead cells in different groups; (D) Colony formation of A549 cells; (E) Relative number of colonies in different groups; (F) Cell migration of A549 cells during 24 h; (G) Migration distance in different groups. *P < 0.05, **P < 0.01. All the experiments were repeated for three times.

Discussion

Exploration of biomarker have been performed in cancer such as breast cancer and liver cancer [2830]. However, not too much progress has been made in LUAD. We first demonstrated that CTSL2 was highly expressed in LUAD, which was significantly associated with age, vital status, and T classification. Moreover, CTSL2 showed the moderate diagnostic value for LUAD. Data mining has been emerged as an approach to find novel biomarkers [31, 32]. The existed biomarkers have not shown satisfied diagnostic and prognostic value [3335]. Therefore, it is necessary to explore novel biomarkers to further solve this problem [3637]. The thymidine kinase 1 was found to improve its diagnostic value for LUAD when combined with carcinoembryonic antigen [38]. Moreover, newly reported biomarkers including uridine-cytidine kinase 2 and long non-coding RNA XLOC_009167 have shown potential value in prognosis [3940]. Together with these findings, our finding that high CTSL2 expression predicts poor prognosis in patients with LUAD also contributes to the biomarker exploration for clinical practice.

CTSL2 belongs to the cathepsins family, which are involved in proliferation, invasion, and metastasis of different kinds of cancers. Upregulation of cathepsin L protein was observed in the conditional K-rasG12D mouse LUAC model [41]. High CTSL2 expression was found in squamous cell carcinoma by high-density oligonucleotide microarray [14]. mRNA level of CTSL2 is significantly increased in endometrial cancer especially in G3 tumors, indicating it may lead to the progression of endometrial cancer [42]. In our study, we found high CTSL2 expression in LUAD tissue and cell by performing bioinformatic analysis and q-PCR. Similarly, Michael et al. reported the prognostic significance of CTSL2 in breast ductal carcinoma in situ [43]. Moreover, our GSEA analysis suggested that high CTSL2 expression may be associated with cell cycle, basal transcription factors, spliceosome, p53 signaling pathway, oocyte meiosis, et al. The phenomenon that CTSL2 promoted the proliferation and migration of A549 cells may be associated with these biological processes and signaling pathways, which needs to be investigated in the future.

In conclusion, high expression of CTSL2 was found in LUAD and associated with clinical progression. High CTSL2 expression was an independent risk factor for OS in LUAD patients. CTSL2 promoted the proliferation and migration of LUAD cells. CTSL2 may serve as a biomarker for diagnosis and prognosis of LUAD. High CTSL2 expression predicts poor prognosis in patients with LUAD.

Materials and Methods

Data mining

Public TCGA (The Cancer Genome Atlas) database was analyzed for data mining with no ethical concern, involving 517 LUAD patients. The RNA expression of CTSL2 was box-plotted. ROC (Receiver operating characteristic) curve was drawn with the AUC (area under curves) calculated using pROC package [44]. The high-expressed and low-expressed groups were determined by identified CTSL2 threshold level. The survival package in R and Cox model was used as previously reported [45]. The covariates included in the multivariate Cox regression model were stage, T, N, M classification, residual tumor, and CTSL2 expression. GSE30219 (analyzing 293 lung tumor and 14 normal lung specimen) and GSE50081 (analyzing 181 Stage I and II non-small cell lung carcinoma) were used for external validation. Evaluation of subgroups was performed as well. GSEA was carried out for identification of CTSL2 expression-related genes and examination of the survival significances. Oncomine database and TIMER database were used for validation of CTSL2 expression.

Sample collection

We collected LUAD and adjacent tissues from 35 patients. The samples were kept in liquid nitrogen immediately after resection, and stored at −80°C. The study was approved by the First Hospital of Jilin University Ethics Committee and conformed to the Declaration of Helsinki.

Cell culture and cell transfection

BEAS-2B, HaCaT, A549, SPCA-1, 95-D, NCI-H292 and PG-49 cell lines were purchased from American Tissue Culture Collection. BEAS-2B, A549, 95-D, and NCI-H292 and were cultured in Dulbecco’s modified Eagle’s medium supplemented with 10% fetal bovine serum. HaCaT, SPCA-1, and PG-49 were cultured in Roswell Park Memorial Institute-1640 supplemented with 10% fetal bovine serum. Antibiotics penicillin and streptomycin (1 %) were used. The cells were cultured at 37°C with 5% CO2. The lentiviral vector containing siRNA targeting CTSL2 was constructed. As previously reported, the transfection of four groups including (a) si-CTSL2: si-CTSL2 transfected group, (b) O-CTSL2: CTSL2 overexpressed group, (c) si-NC: an empty lentiviral vector transfected group as negative control, (d) control: un-transfected group. The validation of over-expression and knockdown efficiency was performed using qRT-PCR.

qRT-PCR

The total RNA extraction was carried out following the instruction of manufacturer (Invitrogen, Thermo Fisher Scientific, USA). Then, the RNA was reversely transcribed into cDNA using the kit (Roche, Basel, Switzerland). The qRT-PCR was performed and the expression of CTSL2 was quantified using 2−ΔΔCt method. The primers were as follows (5′-3′): CTSL2 forward primer, GAAGTCAGAAAGGAAGTACAGAGG; CTSL2 reverse primer, CTCTCCAGTCAACAGATCGTG; β-actin forward primer, ACCCCAAAGCCAACAGA; β-actin reverse primer, CCAGAGTCCATCACAATACC.

Cell proliferation assay

First, plasmid was added into each plate, followed by culturing for 24 h. After adding CCK-8 solution (10 μL), the cells were placed for 20 min. The 490 nm absorbance was measured, and the cell viability was calculated. Calcein AM and PI co-staining and colony formation assay were further performed [44].

Wound healing assay

Calcein AM was used to stain the live cells [44]. The cell migration was recorded using fluorescence microscope, and the migration distance was calculated.

Statistical analysis

R version 3.5.2 package and ggplot2 package in R were used for bioinformatics analysis [4546]. The Wilcoxon rank-sum test and Kruskal-Wallis test were used. The chi-squared test and Fisher's exact test were used for assessing association. Kaplan-Meier and Cox regression were performed to evaluate the effect of CTSL2 expression in the overall survival [47]. GSEA was performed using data from TCGA. The student’s t-test (unpaired, two-tailed) was used to analyze experiment data. P < 0.05 was used as the threshold of statistical significance.

Supplementary Materials

Supplementary Figure 1

Author Contributions

G.W., and W.P. designed this study and had full access to all of data in the study; J.S., and J.J. extracted the data; N.W., and Z.D. analyzed and interpreted the data; J.S., and J.J wrote the paper. All authors reviewed the manuscript.

Conflicts of Interest

The authors declare no conflicts of interest related to this study.

Funding

This study was supported by Jilin university project (No. 2019XZC082).

References

View Full Text Download PDF


Copyright © 2025 Rapamycin Press LLC dba Impact Journals
Impact Journals is a registered trademark of Impact Journals, LLC