Increased cytochrome C threonine 50 phosphorylation in aging heart as a novel defensive signaling against hypoxia/reoxygenation induced apoptosis

Aging increases Cytc T50 phosphorylation

Phosphorylation is a post-translational modification widely existing in vivo and is closely related to apoptosis [12–14]. We, therefore, conducted proteomics in myocardial tissue from young and old mice to determine aging regulation on myocardial protein phosphorylation. A total of 9609 phosphorylation sites were identified on 2957 proteins, of which 8195 sites on 2747 proteins contained quantitative information. Using P-value<0.05 as a cut-off, the change in the amount of differential modification >1.3 was considered as significantly up-regulated and less than 1/1.3 as significantly down-regulated. (Figure 1A, 1B) The classification of proteins with statistical differences were based on the GO annotation. Respectively, Figure 1A, 1B showed the up-regulation and down-regulation of biological function in the old group. The differentially modified proteins were compared with STRING (V.10.5) protein network interaction database to determine the protein interaction network (Figure 1C). Phosphorylation changes have occurred in many essential apoptotic regulatory proteins, among which the T50 phosphorylation of Cytc attracted our attention. The level of this change was very significant (1.779 times greater in the old group than the young), and Cytc is closely related to some of the apoptosis regulators by bioinformatics analysis (Figure 1D). Surprisingly, this site has not been functionally annotated. Omics results showed a difference in its content between the old and young groups (P < .001, Figure 1E). We verified this result by Western Blot (P < .05, Figure 1F) by utilizing the antibody prepared in Figure 2.

Figure 1. Aging increases Cytc T50 phosphorylation. Compared with the young, GO annotation revealed that biological function was up-regulated (A) in the old group and down-regulated (B). (C) Relationships between different proteins. (D) Magnified (Figure 1C) portion. (E) T50 expression is different in young and old heart tissue from proteomics. (F) T50 levels in isolated cardiomyocytes (from 8 weeks and 18 months-old mouse hearts) were measured by Western Blot, with specific antibody in Figure 2. n=5 in each group. Data expressed as mean±SD. *** P < .001 vs. young, * P < .05 vs. young.

Figure 2. Preparation and validation of specific antibodies. (A) Antigenic peptide sequences. (B) Time of antigen injection and blood collection. (C) Validation antibody by IHC.

Preparation and validation of specific antibodies

To verify the omics results, specific antibodies were prepared. Using specific antigenic peptide sequences from NCBI (Figure 2A), they were injected into New Zealand White Rabbits four times (Figure 2B). Antibodies were extracted from rabbit blood. The efficacy of the antibody was verified by IHC and Western blot. As illustrated in Figure 2C, the intensity of immunostaining for T50 phosphorylation was markedly enhanced in the old group, compared with the young. The result of Western blot also demonstrated antibody specificity (Figure 1F).

Gene manipulation successfully altered the expression of Cytc variants

To study the effect of T50 phosphorylation of Cytc on apoptosis, we generated T50E phosphomimetic Cytc. Phosphomimetic amino acid replacement can functionally mimic protein phosphorylation and be used to model the functional effects of fully phosphorylated proteins [15, 16]. We also constructed human Cytc expression plasmids for WT and T50A as a non-phosphorylatable control. An empty plasmid served as a negative control. Transfection efficacy is reported in Figure 3A. No significant efficacy differences existed among the lentivirus-treated four groups. Successful expression was confirmed by Western blotting. No difference was found among the three groups (Figure 3B).

Figure 3. Gene manipulation successfully altered the expression of Cytc variants. (A) Transfection efficiency, 48 hours after lentiviral transfection of cardiomyocytes. Transfection efficiency is indicated by concomitant contrast and fluorescence microscopy. Lentiviral vectors carried GFP gene. Cardiomyocytes infected by Cytc variants-carrying lentivirus are identifiable by fluorescence microscopy 48 hours after infection. (B) Representative immunoblots of Cytc. There were no statistical differences in WT, T50E and T50A.

Cytc T50 phosphorylation suppresses H/R-induced apoptosis

Four types of Cytc lentiviral vectors were utilized to infect AC16 cells. After H/R treatment, the effects of gene manipulation upon cardiomyocytes apoptosis were assessed by TUNEL staining and flow cytometry analysis. Compared with NC group, TUNEL staining results showed a significant augment of total TUNEL positive nuclei in the other three groups (P < .01, Figure 4A, 4B). Compared with WT, the cell apoptosis rate in the T50E group was significantly lower (P < .05, Figure 4A, 4B). In contrast, the cell apoptosis rate is significantly higher in T50A group (P < .01, Figure 4A, 4B). Consequently, the cell apoptosis ratio in the T50A group was dramatically higher than T50E (P < .01, Figure 4A, 4B). Consistently, the results of flow cytometry analysis showed reduced apoptosis rate in T50E group (P < .05) and increased apoptosis in T50A group when compared with WT group (P < .05, Figure 4C, 4D). The ratio of apoptosis in T50A was significantly higher than T50E (P < .01, Figure 4C, 4D).

Figure 4. Cytc T50 phosphorylation suppresses H/R induced apoptosis. (A) Representative photomicrographs of in situ detection of cardiomyocytes DNA fragments from AC16 cells subjected to H/R. Cardiomyocytes were stained with DAPI (blue) and TUNEL (green). (B) TUNEL-positive nuclei were summarized in a graph and expressed as a percentage of all cardiomyocytes subjected to H/R. (C) Apoptosis in AC 16 cells were analyzed by flow cytometry. (D) Quantitation of apoptosis data in flow cytometry. n=3 in each group. Data expressed as mean±SD. ** P < .01 vs. NC, # P < .05 vs. WT, ## P < .01 vs. WT, && P < .01 vs. T50E.

Effects of T-50 phosphorylation of Cytc on caspase and Bcl-2 family activity

Bcl-2 family members are important apoptosis regulatory factors. They can increase mitochondrial membrane permeability and promote Cytc to release from the mitochondria into the cytosol. Once Cytc is released into the cytosol, it interacts with the apoptotic protease activating factor 1 to activate the caspase-9 and the downstream caspase cascade, leading to cell death [17]. This is the general process in which Cytc participates in apoptosis. In order to study the potential mechanism of T50 phosphorylation affecting apoptosis, we detected its upstream and downstream factors. Compared with NC, caspase-9 and caspase-3 activity were significantly increased in the other three groups by ELASA assay (P < .01, Figure 5A, 5C). Compared with WT group, the activity of caspase-9 and caspase-3 was significantly lower in T50E group while much higher in T50A (P < .01, Figure 5A, 5C). T50A had a significantly higher activity of caspase-9 and caspase-3 compared with T50E (P < .01, Figure 5A, 5C). Western blot analysis demonstrated that cleaved caspase-9/GAPDH and cleaved caspase-3/GAPDH in T50A are higher than those in T50E (P < .01, Figure 5B, 5D). However, no significant difference was observed on caspase-8, BCL-2, Bax, BCL-2/Bax and BCL-XL (Figure 5E–5I).

Figure 5. Effects of Cytc T-50 phosphorylation on caspase and Bcl-2 family activity. ELISA determination of caspase-9 (A), caspase-3 (C) and caspase-8 activity (E) in cardiomyocytes transfected with lentivirus. Representative Western blot and quantitative levels showing the expression of cleaved caspase-9 (B), cleaved caspase-3 (D), BCL-2 (F), Bax (G), BCL-2/Bax (H) and BCL-XL (I). n=3 in each group. ** P < .01 vs. NC, ## P < .01 vs. WT, && P < .01 vs. T50E.

Mouse heart harvest

Approved by the institutional ethics committee, this study was in compliance with the United States National Institutes of Health guidelines. Male C57 mice (aged eight weeks and 18 months) were anesthetized with sodium pentobarbital. Mouse hearts were harvested by exteriorizing the heart via a left thoracic incision.

Phosphoproteomic analysis

Heart tissue from young and old mouse were harvested and delivered to PTM-Biolab Co., Ltd. (Hangzhou, China) for phosphoproteomic analysis. The quantitative study of phosphorylated proteomics used TMT labeling and phosphorylated enrichment techniques and high-resolution liquid chromatography-mass spectrometry.

GO annotation

Gene Ontology (GO) annotation proteome was derived from the UniProt-GOA database (http://www.ebi.ac.uk/GOA/). Firstly, converting identified protein ID to UniProt ID and then mapping to GO IDs by protein ID. If some identified proteins were not annotated by UniProt GOA database, the InterProScan soft was used to annotate protein’s GO function based on the protein sequence alignment method. Then proteins were classified by Gene Ontology annotation based on three categories: biological process, cellular component, and molecular function.

Protein-protein interaction network

All differentially expressed and/or modified protein database accession or sequence were searched against the STRING database version 10.5 for protein-protein interactions. Only interactions between the proteins belonging to the searched data set were selected, thereby excluding external candidates. STRING defines a metric called “confidence score” to define interaction confidence; we fetched all interactions that had a confidence score >0.7 (high confidence).

Functional identification

Antibody production

A special antibody was ordered from PTM-Biolab Co., Ltd. an antigen. Specific antibody response was examined with immunohistochemistry staining.

Western blot

Myocardial tissue and AC16 cells were homogenized in an ice-cold lysis buffer. After homogenization, the lysates were centrifuged. The supernatant was saved and separated by electrophoresis on SDS-PAGE and transferred onto polyvinylidene difluoride-plus membranes. After blocking buffer, the immunoblots were probed with anti-T50 phosphorylation of Cytc(CL090701, PTM Bio), anti-Cytc(#ab13575, Abcam), anti-Cleaved Caspase-3(#ab184787, Abcam), anti-Caspase-3(sc-7272, Santa Cruz Biotechnology), anti-Cleaved Caspase-9(#ab2324, Abcam), anti-Caspase-9(sc-56076, Santa Cruz Biotechnology), anti-BCL-2(sc-7382, Santa Cruz Biotechnology), anti-BCL-XL(sc-8392, Santa Cruz Biotechnology), anti-Bax(sc-7480, Santa Cruz Biotechnology), and anti-GAPDH(60004-1-lg, Proteintech) antibodies overnight at 4° C, followed by incubation with fluorescent-conjugated secondary antibodies(A0208, Beyotime) at room temperature for 1 hour.

Immunohistochemistry staining

Paraffin sections made from young and aged mouse hearts were used for immunohistochemistry assays to detect protein expression levels of T50 phosphorylation of Cytc proteins. In accordance with the manufacturer’s instruction, tissue sections stained immunohistochemically are determined separately by two pathologists using the indirect streptavidin peroxidase method. The primary antibodies against T50 (CL090701, PTM Bio) and horseradish peroxidase-conjugated IgG were used in this study. Then, the proteins were visualized in situ by the use of 3, 3 diaminobenzidine kit (BioGenex, Fremont, CA, USA).

Lentivirus vector construction

Three sequences of WT, T50E and T50A were synthesized after codon optimization, purchased from Sangon Biotech Co., Ltd. (Shanghai, China). To study the effect of T50 phosphorylation in vitro, we generated T50E for constant phosphorylation and T50A for non-phosphorylation. Three sequences of WT, T50E and T50A are as below. WT:ATGGGTGATGTTGAGAAAGGCAAGAAGATTTTTATTATGAAGTGTTCCCAGTGCCACACCGTTGAAAAGGGAGGCAAGCACAAGACTGGGCCAAATCTCCATGGTCTCTTTGGGCGGAAGACAGGTCAGGCCCCTGGATACTCTTACACAGCCGCCAATAAGAACAAAGGCATCATCTGGGGAGAGGATACACTGATGGAGTATTTGGAGAATCCCAAGAAGTACATCCCTGGAACAAAAATGATCTTTGTCGGCATTAAGAAGAAGGAAGAAAGGGCAGACTTAATAGCTTATCTCAAAAAAGCTACTAATGAGTAA. T50E:ATGGGTGATGTTGAGAAAGGCAAGAAGATTTTTATTATGAAGTGTTCCCAGTGCCACACCGTTGAAAAGGGAGGCAAGCACAAGACTGGGCCAAATCTCCATGGTCTCTTTGGGCGGAAGACAGGTCAGGCCCCTGGATACTCTTACGAGGCCGCCAATAAGAACAAAGGCATCATCTGGGGAGAGGATACACTGATGGAGTATTTGGAGAATCCCAAGAAGTACATCCCTGGAACAAAAATGATCTTTGTCGGCATTAAGAAGAAGGAAGAAAGGGCAGACTTAATAGCTTATCTCAAAAAAGCTACTAATGAGTAA. T5OA:ATGGGTGATGTTGAGAAAGGCAAGAAGATTTTTATTATGAAGTGTTCCCAGTGCCACACCGTTGAAAAGGGAGGCAAGCACAAGACTGGGCCAAATCTCCATGGTCTCTTTGGGCGGAAGACAGGTCAGGCCCCTGGATACTCTTACGCCGCCGCCAATAAGAACAAAGGCATCATCTGGGGAGAGGATACACTGATGGAGTATTTGGAGAATCCCAAGAAGTACATCCCTGGAACAAAAATGATCTTTGTCGGCATTAAGAAGAAGGAAGAAAGGGCAGACTTAATAGCTTATCTCAAAAAAGCTACTAATGAGTAA. With these sequences, construct lentivirus vectors, purchased from Shanghai Yibeirui Bio-pharmaceutical Technology Co., Ltd. (Shanghai, China).

Cell culture and transfection

Human adult ventricular cardiomyocyte cell line AC16 was purchased from the American Type Culture Collection (ATCC; Manassas, VA, USA). Cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM; Invitrogen, Carlsbad, CA, USA) containing 10% fetal bovine serum (FBS; HyClone, Logan, UT, USA) and 1% penicillin/streptomycin in a humidified incubator with 5% CO2 at 37° C. In this study, four types of lentiviruses were used to infect AC16 cells. Infection efficiency was monitored by fluorescence microscopy 48 hours post lentivirus infection.

H/R-induced cardiomyocyte apoptosis

In vitro cardiomyocyte H/R model

Seventy-two hours after cardiomyocyte transfection, all groups were treated with hypoxia (95% N2 and 5% CO2) for 6 hours (via Anaerobic Bag, Becton Dickinson and Company Inc., Franklin Lakes, NJ, USA), followed by normoxia (74% N2, 21% O2, and 5% CO2) for 2 hours.

TUNEL staining

Cardiomyocytes were cultured directly upon coverslips. TUNEL staining was performed per the manufacturer’s instructions (In Situ Cell Death Protection Kit, Fluorescein, Roche, Indianapolis, IN, USA). Total nuclei were stained by DAPI (Vector Laboratories Inc., Burlingame, CA, USA). Apoptotic index (i.e., the number of positively stained nuclei/total number of nuclei counted × 100%) was determined via blinded manner.

Flow cytometry analysis

After incubation for two days, the harvested cells were used for apoptotic determination by two methods. First, the apoptotic rate of transfected cells was evaluated by using Annexin V APC/PI apoptosis detection kit (KeyGEN) by following the manufacturer’s instruction and then analyzed using FACScan. All tests are carried out in triplicate. Second, by following the manufacturer’s instructions, Caspase-9 and Caspase-3 levels were detected utilizing human Caspase-9 ELISA kit (BC3890), Caspase-3 ELISA kit (BC3830) and Caspase-8 ELISA kit (BC3880) from Beijing Solarbio Science and Technology Co., Ltd. (Beijing, China).

Statistical analysis

The data were analyzed with Prism 8.0 (GraphPad Software, San Diego, CA, USA). All values in the text and figures are presented as mean ± SD. Statistical differences were determined by Student’s t-test for comparison between 2 groups and ANOVA followed by Bonferroni multiple comparison test for comparison among ≥3 groups. Probabilities of.05 or less were considered statistically significant.

Data availability

The data used to support the findings of this study are available from the corresponding author upon request.

Limitation

In this study, phosphoproteomics were performed only in myocardial tissue from young and old mice, which reduces the targeting of the experiment. The relationship between T50 phosphorylation and mitochondrial release or caspase 9 interaction will be explored in the next step. In addition, the functional impact of Cytc T50 phosphorylation in vivo or clinical significance should be explored in the future.