Involvement of Daphnia pulicaria Sir2 in regulating stress response and lifespan

Daphnia Sir2 protein shows sequence conservation of residues essential for its enzyme activity

The D. pulex genome contains five homologs in the sirtuin gene family and we wanted to assess sequence conservation in the essential catalytic domain of Sir2, the one-to-one ortholog of human Sirt1. Such conservation would be indicative of similar catalytic protein deacetylase activity of the Daphnia protein. Thus, we aligned the Sir2 protein sequence from the published D. pulex genome with previously studied Sir2/Sirt1 sequences from other organisms. As is shown in figure 1A, there is a high degree of sequence similarity between the catalytic domain of Daphnia Sir2 and the sequences from Drosophila, human, mouse, and worms. Of particular note, the residues that exhibit the highest conservation include those from the domains of the protein essential for the deacetylase enzyme functions such as NAD+ and substrate binding. The alignment in figure 1A shows the part of D. pulex Sir2 that exhibits the highest homology with the corresponding regions from other organisms known to be required for the catalytic function of the Sir2 enzyme.

Characterization of Daphnia Sir2

Using PCR to amplify the open reading frame (ORF) in two overlapping pieces as outlined in Figure 1 B, we first obtained the 5′ and 3′ halves of D. pulicaria Sir2 ORF. After verification of the sequence of the PCR products, using the internal restriction enzyme MscI, we joined the two halves as outlined in methods section to create a complete ORF that would be capable of coding for the entire Sir2 protein. We sub-cloned the Sir2 ORF in a mammalian expression vector pcDNA3.1- (Invitrogen) with a Flag tag on its N-terminus so we could check its expression in cell culture as well as in an in vitro transcription–translation system to obtain a full-length Sir2 protein for measuring its catalytic activity. Thus, in order to determine if the cloned Daphnia ORF would produce a functional enzyme, we performed two experiments, one to determine the expression of Sir2 in mammalian cells and another to ensure enzymatic activity of the Sir2 produced by in vitro translation of the ORF. Currently there are no Daphnia or other crustacean cell lines available, thus we used mammalian cells to express Daphnia Sir2. Figure 2A depicts a western blot analysis of the protein extract from Cos-1 cells transfected with Daphnia FLAG-Sir2/pcDNA3.1- expression construct or with a positive control FLAG-TRBP/pcDNA3.1-. The FLAG-TRBP/pcDNA3.1- serves as a positive control for the transfection, expression, and western blot as we have used this plasmid for many studies previously [42, 43]. As seen in lane 1, the band just above the 100 kD molecular weight marker corresponds to Daphnia FLAG-Sir2. The calculated molecular weight of Daphnia Sir2 based on its primary sequence is 67kD, however, Sir2 proteins including mammalian Sirt1 are known to run higher on the SDS-PAGE gels than their calculated molecular weight based on the primary sequence, which results from the heavy post-translational modifications. Lane 2 indicates a strong expression of FLAG-TRBP, which is known to express extremely strongly based on our previous work [42, 43]. As expected, there is no band present in lane 3 as it contains extract from Cos-1 cells transfected with empty vector pcDNA3.1-, which will not express Flag-Sir2. Thus, the Daphnia Sir2 is expressed in Cos-1 cells and produces a full-length protein.

We next wanted to determine if the protein produced from the Daphnia Sir2 ORF has deacetylase activity similar to Sir2 from other organisms. We used the FLAG-Sir2/pcDNA3.1- construct to produce an in vitro translated Daphnia Sir2 protein using the TNT T7 coupled reticulocyte system (Promega). The protein was synthesized using S³⁵ labeled methionine and its production and integrity was checked by SDS-PAGE followed by a phosphorimager scan (data not shown). The deacetylase activity present in the reticulocyte lysate was measured using a Sirt1 Activity Assay kit (Abcam). Shown in Figure 2B, the reticulocyte lysate containing in vitro translated Daphnia Sir2 exhibits deacetylase activity (blue bar). A human recombinant Sirt1 sample that was supplied with the kit was used as a positive control (green bar). Note that a reticulocyte lysate only control was performed as a negative control with no Sir2/pcDNA3.1- DNA added as this represents the activity present in reticulocyte lysate. The activity obtained from this negative control is subtracted from the values displayed in Figure 2B. The red and the black bars represent the enzyme activity in presence of a Sir2 specific inhibitor Ex527 and establish that both the human recombinant Sirt1 as well as Daphnia Sir2 activity is significantly diminished by the inhibitor. These results further confirm that the cloned ORF encodes a functional Sir2 protein.

Daphnia Sir2 protects against proteotoxic stress similar to mammalian Sirt1

In order to verify the functional activity of Daphnia Sir2, we tested if Daphnia Sir2 would offer protection against heat shock in a mammalian cell culture system. Previous work on mammalian Sirt1 in 293T cells established that Sirt1 overexpression provided protection to the cells during severe heat shock [17]. To assess if Daphnia Sir2 overexpression would offer similar protection, we transfected Cos-1 cells with the Daphnia Sir2 expression construct and measured the cell viability following a severe heat shock. Shown in Figure 3A, Daphnia Sir2 overexpression in Cos-1 cells resulted in lower percentage cell death following a heat shock. With 20 minutes of heat shock, there was 25.67 +/− 1.62% cell death in cells transfected with empty vector without any Sir2 ORF insert (blue bar). In contrast to this, only 15.74 +/− 2.74% cell death was observed with Sir2 overexpression construct (red bar). When duration of heat shock was 30 minutes, the differences in percentage was greater with control being at 34.79 +/− 1.63% cell death (blue bar) and Sir2 overexpression sample showing 20.90 +/− 1.27% cell death (red bar). Thus, Daphnia Sir2 overexpression is clearly protective to mammalian cells following heat shock, potentially acting via the deacetylation of the transcription factor HSF1. The results also indicate that Daphnia Sir2 has an enzymatic activity similar to Drosophila Sir2 and mammalian Sirt1.

In order to further analyze Daphnia Sir2's potential in regulating response to proteotoxic stress, we performed co-transfection experiments in Cos-1 cells using Daphnia Sir2 expression construct and a luciferase reporter pGL4.41 (Promega), which is regulated transcriptionally by proteotoxic stress. pGL4.41 contains four mammalian heat shock elements (HSEs) that serve as binding sites for HSF1 [1] to induce the transcription of the downstream reporter firefly luciferase ORF only when proteotoxic stress (heat shock or heavy metals) is present. Thus, under proteotoxic conditions, there is an induction of luciferase activity via the activation and binding of HSF1 to the HSEs in pGL4.41. We co-transfected the Daphnia Sir2 expression construct and pGL4.41 and treated cells with cadmium chloride (CdCl₂) to induce proteotoxic stress. As shown in Figure 3B, overexpression of Daphnia Sir2 caused a dose-dependent increase in luciferase activity after CdCl₂ treatment as compared to empty vector control where no Daphnia Sir2 was present. The empty vector control (blue bar) showed a 140.50 +/− 4.95 fold induction in response to CdCl₂. Co-transfection of 5 ng and 10 ng of Daphnia Sir2 expression construct resulted in 164.16 +/− 11.9, and 242.18 +/− 12.72 -fold induction respectively (red bars). Thus, Daphnia Sir2 overexpression in a mammalian cell culture system results in a more robust cellular response to proteotoxic stress, potentially via the deacetylation of HSF1.

Daphnia Sir2 mRNA levels increase with age in D. pulicaria

The expression of Hsp70 in response to a heat shock decreases with increasing age in D. pulicaria [12], which may be due to a decreased expression of Sir2. In order to analyze the expression of Sir2 during the lifespan of D. pulicaria, we examined the Sir2 transcript levels at ages 1, 4, and 8 weeks. Total RNA was isolated, converted to cDNA, and real time PCR was performed to examine the relative amount of Sir2 mRNA. As represented in Figure 4, D. pulicaria steady state Sir2 mRNA levels increased with age. These results indicate that decreased expression of Sir2 mRNA is not a likely cause of decreased HSR and reduced Hsp70 expression in response to proteotoxic stress in old organisms.

We next examined if Sir2 enzyme activity declines with age in D. pulicaria. Sir2 activity assays were performed using a commercially available kit (Abcam). As represented in Figure 5, Sir2 activity of D. pulicaria declines with age, 1 wk old organisms displayed the highest activity of Sir2 (410.0 +/− 12.02 RFUs, first blue bar from the left), followed by 4 wk old D. pulicaria (248.6 +/− 4.36 RFUs, second blue bar from the left) and the 8 wk old organisms had the lowest amount of Sir2 activity (178.2 +/− 5.44 RFUs, third blue bar from the left). To ascertain that we were measuring Sir2 activity, we tested the enzyme activity in presence of Ex-527, a known specific inhibitor for Sirt1. As seen in figure 5 (1 wk + Ex527; red bar and human Sirt1 + Ex527; black bar), the deacetylase activity drops to background levels (grey bar labeled C) in the presence of 800 nM Ex527. Thus, it can be concluded that the commercially available assay system works efficiently to assay Daphnia Sir2 activity and that Sir2 activity declines with age in D. pulicaria.

Targeted knockdown of Sir2 expression via RNAi shortens D. pulicaria lifespan and enhances death following proteotoxic stress

A decline in Sir2 activity has been shown to be responsible for aging phenotypes of various model organisms [44]. In addition, evidence exists for extension of lifespan by enhancing Sir2 activity with nutraceuticals or by overexpression in model organisms [19, 44]. Thus, we next examined if a targeted knockdown of Sir2 activity in D. pulicaria would shorten the lifespan. We recently developed an effective RNAi method for adult Daphnia via feeding. In order to achieve RNAi for the gene of interest, a double-stranded RNA (dsRNA) corresponding to a selected region in the target mRNA is expressed in E.coli using the L4440 vector [41, 45]. Daphnia are fed on these bacteria to deliver the dsRNA systemically via the gut. Using this method we have previously achieved effective RNAi of phenoloxidase expression in D. melanica and eyeless expression in D. melanica and D. pulicaria [41], unpublished). Figure 6A shows the map of the targeting construct for Daphnia Sir2 using the first 863 bp of the Sir2 transcript. We used ten D. pulicaria per beaker in 100 ml of COMBO for feeding them the bacteria that expressed Sir2 or GFP dsRNA for 10 days, after which we checked if gene–specific RNAi was achieved. To ensure that the Sir2 specific RNAi was achieved, we analyzed the steady state Sir2 mRNA levels after the RNAi feeding regimen. Figure 6B displays data from a representative reverse transcriptase PCR demonstrating a knockdown in Sir2 mRNA only in RNA isolated from D. pulicaria fed on Sir2 dsRNA expressing bacteria (lane 3). RNA isolated from D. pulicaria fed on bacteria expressing GFP dsRNA (lane 2) and wild-type D. pulicaria controls not fed on bacteria (lane 1) both have constitutive levels of Sir2 mRNA expression with little variation in Sir2 transcript levels. Thus, our targeting Sir2 dsRNA construct achieved very effective and specific Sir2 knockdown. In order to measure the effect of Sir2 knockdown on viability of Daphnia after a heat shock, we first determined the optimal heat shock conditions. We subjected D. pulicaria to a range of elevated temperatures as indicated in figure 6C and measured percentage death 24h after heat shock. Based on these results we selected 34⁰ C as the heat shock temperature, as it would allow us to measure an increase or a decrease in lethality after Sir2 knockdown. To analyze the effect of Sir2 knockdown on the HSR, Daphnia that were fed no bacteria (blue bar labeled “– “, Figure 6D), bacteria with a control construct (encoding GFP dsRNA- green bar, Figure 6D), or bacteria with the Sir2 targeting construct (encoding Sir2 dsRNA- red bar, Figure 6D) for ten days were heat shocked at 34°C for 30 minutes. As seen in Figure 6D, the Daphnia fed on bacteria with sir2 dsRNA had a significantly higher percentage of death following heat shock (red bar: 90 +/− 4.3%), compared to the negative control GFP (green bar: 67 +/− 5.0%), and wild type D. pulicaria (blue bar: 59 +/− 3%). Thus, when Sir2 is knocked down in D. pulicaria, the organism no longer responds appropriately to proteotoxic stress leading to death following a heat shock.

In addition to the deleterious effect of Sir2 knockdown on HSR, we further analyzed the effect of Sir2 knock down on the lifespan of D. pulicaria. Sir2 knockdown or mutation has been shown to cause a decline in lifespan for numerous organisms, including yeast, C. elegans, and D. melanogaster [21-23]. We used ten Daphnia neonates per beaker in 100 ml of COMBO and subjected them to an RNAi feeding regimen as described in methods. We followed these Daphnia throughout life, feeding them daily with either no bacteria (WT, control), bacteria expressing GFP dsRNA, or bacteria expressing Sir2 dsRNA. The water was changed every other day and reproduction and death was noted for each treatment group. In Figure 7A, the survivorship curves of Daphnia on the RNAi feeding regimens are displayed. WT Daphnia fed just algae throughout the course of the experiment lived the longest with the median lifespan being 31 +/− 2 days (blue line). The Daphnia fed on bacteria expressing GFP dsRNA had a median lifespan of 29 +/− 1.8 days (green line) and the Daphnia fed on bacteria expressing Sir2 dsRNA had a median lifespan of only 11 +/− 2.5 days (red line). Note that juvenile mortality was removed from this experiment to examine the overall lifespan effects of Sir2 knockdown on adult Daphnia. Overall, a knockdown of Sir2 by RNAi resulted in a 64 +/− 2% reduction in lifespan of D. pulicaria compared to WT D. pulicaria. These results are statistically significant as analyzed by a nonparametric log rank test (X²=19.1, p-value=1.2×10⁻⁵ comparing WT to Sir2 dsRNA fed sample, X²=18.098, p-value=2.1×10⁻⁵ comparing GFP dsRNA fed sample to Sir2 dsRNA fed sample). The lifetime offspring production was also drastically different for the three groups (Figure 7B) with WT producing an average 20.05 +/− 2.26 offspring per individual (blue bar), GFP dsRNA treated with 25.85 +/− 2.73 offspring per individual (green bar) and Sir2 dsRNA treated Daphnia only producing 4.5 +/− 0.75 offspring per individual (red bar). These results establish that Sir2 activity is required for maintaining survival and reproduction in addition to being required for an efficient protective response to proteotoxicity (Figure 6). This is the first report that uses RNAi to examine the effects of the knockdown of a longevity gene in the emerging model system of Daphnia.

Cloning of Daphnia Sir2 ORF to verify expression of functional protein

Primers were designed to clone the Daphnia pulicaria Sir2 ORF using MacVector based on the published D. pulex genome (DappuDraft_290541: wFleaBase) [36]. We designed four primers such that the two PCR products would cover the entire ORF in two overlapping pieces, the “5′ half” (883 bp) and the “3′ half” (1065 bp) with an overlap of 46 bp (Figure 1B) between the two halves around an internal MscI restriction enzyme site. The primers were designed with a restriction site Nde1 for the 5′ end of the 5′half and BamHI for the 3′ end of the 3′half (sequence of primers is given in the next section). The PCR products were cloned into pGEMT-EZ (Promega) and the sequence of D. pulicaria Sir2 ORF was confirmed and submitted to GenBank (KT960973). We utilized the internal MscI restriction enzyme cut site to join each half of the Sir2 PCR product from their respective 5′half Sir2/pGEMT EZ and 3′half Sir2/pGEMT EZ constructs. A three-piece ligation was performed to join the two halves of the Daphnia Sir2 ORF thereby sub-cloning the full length ORF into the pBSIIKS+ (Stratagene) that contained an in-frame FLAG tag on the amino terminus of Sir2. A final sub-cloning in pcDNA3.1- (Invitrogen) resulted in the FLAG- Sir2/pcDNA 3.1- expression construct used for this study.

Reverse transcriptase PCR

Total RNA was isolated from D. pulicaria using RNAzol B reagent (TelTest). cDNA was synthesized at using random hexamer primers, 1 μg total RNA, M-MuLV reverse transcriptase, 500 μM dNTPs, and RNase Inhibitor RNasin (Promega) as previously described [12]. For each PCR reaction, 2 μl of total cDNA and 50 pmoles each of the forward and reverse primers were used with the Promega GoTaq PCR kit. The following conditions were used for PCR: 95⁰ C for 5 minutes (initial denaturation), denaturation at 95⁰ C for 30 seconds, annealing at 56° C for 5′ half Sir2, 58⁰ C for 3′ half Sir2, or 59⁰ C for GAPDH for 30 seconds, extension at 72° C for 60 seconds. We ran 40 cycles for the initial amplification of Daphnia Sir2 5′ and 3′ halves for cloning, and 27 cycles for the analysis of sir2 mRNA knockdown in the RNAi experiment. The linear range was determined by varying cycle numbers and performing a densitometric analysis of the amplified product for the reverse transcriptase PCR in the RNAi experiment. Note the Sir2 PCR product shown in Figure 6B is the 3′ half of Daphnia Sir2 ORF. Primer sequences used were as follows:

5′ half Sir2

Forward:

5′CATATGACCATGGCCGACGAACAAGGCGAG3′

Reverse:

5′ATGTTCTGCGTGTAGTTGCG3′

3′ half Sir2

Forward:

5′CGACCGTTCTTTAAATTCGC3′

Reverse:

5′TCAATCCATCGCTTTCCTTTTTAC3′

GAPDH

Forward:

5′TTATCACCTCCTCAACTTC3′

Reverse:

5′CTTCTTCCTTCACTTCTCC3′

Western blot analysis to confirm expression of Daphnia FLAG Sir2

Cos-1 cells were transfected with 100 ng FLAG-Sir2/pcDNA3.1- or control FLAG-TRBP/pc DNA3.1-. 24 hours post-transfection, Cos-1 cells were harvested, washed with 1 ml of cold PBS twice and lysed in RIPA Buffer (150 mM NaCl, 1.0% IGEPAL, 0.5% sodium deoxycholate, 0.1% SDS, 50 mM Tris, pH 8.0), the lysates were centrifuged at 13000 Xg for 5 minutes at 4°C and the supernatants were used as total protein extracts. Total protein concentrations in the extracts were determined using the BCA kit (Pierce). 50 μg of protein per sample was resolved by SDS-PAGE on an 8% polyacrylamide gel. The primary antibody used was FLAG M2 from Sigma at a dilution of 1:2000. ECL plus (Pierce) chemifluorescence detection was used to detect signals on a GE Typhoon LAS4000.

In vitro translation of Daphnia Sir2

Daphnia Sir2 was in vitro translated using the TNT T7 coupled reticulocyte system (Promega). We incorporated S³⁵ methionine during translation to radioactively label Daphnia Sir2. Following in vitro translation, an SDS-PAGE was analysis was performed with an 8 % polyacrylamide gel that confirmed the presence of a radioactively labeled protein the same size as Daphnia Sir2. In vitro translated protein was then used in the Sirt1 Activity Assay.

Sir2 activity assay to verify deacetylase activity of Daphnia Sir2 and to examine changes with age

We assayed for the deacetylase activity of D. pulicaria Sir2 using a commercially available kit from Abcam (ab156065). The kit is designed to measure the activity of any sirtuin; however, we used the Sirt1/Sir2 specific inhibitor EX-527 to determine the relative contribution of Sir2 activity present in Daphnia samples isolated from 1, 4, and 8 week-old organisms as well as in vitro translated Daphnia Sir2. The assay is based upon a proprietary substrate, which contains a fluorophore coupled to an acetylated peptide that also contains a quencher. Upon deacetylation, the quencher is cleaved by a peptidase included in the kit, and the fluorophore fluoresces, which is measured using a plate reader. In general, the higher the amount of fluorescence emitted, the higher the amount of Sirt1/Sir2 activity. All assays were performed using an opaque clear bottomed 96 well plate (UVstar from Greiner). Ten Daphnia, with embryos removed, were homogenized in lysis buffer (10 mM Tris HCl (pH 7.5), 10 mM NaCl, 15 mM MgCl₂, 250 mM sucrose, 0.5% NP-40 and 0.1 mM EGTA). The samples were incubated on ice for 15 minutes and spun through 4 ml sucrose cushion (30% sucrose, 10 mM Tris HCl (pH 7.5), 10 mM NaCl, 3 mM MgCl₂) at 1300 X g for 10 minutes at 4°C. The supernatant was discarded and the nuclear pellet was resuspended in ice-cold solution of 10 mM Tris HCl and 10 mM NaCl and pelleted via centrifugation at 1,300 X g for 10 minutes at 4°C. The washed, pelleted nuclei were lysed in 50 μl of extraction buffer (50 mM Hepes-KOH, pH 7.5, 420 mM NaCl, 0.5 mM EDTA Na₂, 0.1 mM EGTA, 10% glycerol) by gentle homogenization. The samples were incubated on ice for 30 minutes and centrifuged for 10 minutes at 20000 x g. The supernatant, the crude nuclear extract, was stored at −80°C until use in the assay. Protein concentration of the extracts was determined using the BCA kit (Pierce). The Sirt1 Activity Assay was performed as per the manufacturer's directions. We used human recombinant Sirt1 as a positive control and EX-527 to ensure Sirt1 specificity. All plates were read on a Molecular Devices Gemini EM Microplate reader with an excitation wavelength of 340 nm and emission wavelength of 460 nm for the duration of 30 minutes with reads occurring every minute.

Mammalian cell viability assay to confirm Daphnia Sir2 function

Cos-1 cells were transfected with 500 ng Daphnia Flag-Sir2/pcDNA3.1- expression construct or 500 ng empty vector pcDNA3.1- using Effectene (Qiagen). 24h after transfection the cells were subjected to a severe heat shock for either 20 minutes or 30 minutes at 42⁰ C. The control cells (without heat shock) remained at 37⁰ C for the duration of the entire experiment with no changes in viability (data not shown). 24 hours following the heat shock, cell viability was determined via Trypan Blue viability assay. Trypan Blue staining was done by mixing 200 μl of trypsinized cell suspensions with 200 μl of Trypan Blue followed by an incubation at room temperature for 3 minutes. The cell mixture was mixed briefly and 20 μl of this suspension was loaded onto a hemacytometer slide and cell viability was determined by counting the blue cells (dead cells) and total cells visualized by a light microscope. The percentage viability was calculated by counting at least 300 cells in each sample.

Luciferase reporter assays to demonstrate Daphnia Sir2's role in response to proteotoxic stress

Cos-1 cells were co-transfected with Daphnia Flag-Sir2/pcDNA3.1- expression construct along with 1 ng pRL null (Promega) and 250 ng pGL4.41 (Promega) using Effectene (Qiagen) as per the manufacturer's instructions. pGL4.41 has the firefly luciferase gene under the control of 4 tandem copies of a consensus mammalian heat shock element (HSE). 24h after transfection the cells were treated with 30 μM CdCl₂ to induce proteotoxic stress. For treatment with CdCl₂, the culture medium was removed and replaced with DMEM with charcoal stripped FBS containing 30 μM CdCl₂. Six hours following the addition of CdCl₂, the cell extracts were harvested and the luciferase activity was measured using the Promega dual luciferase reporter system as per the manufacturer's instructions. The firefly luciferase activity was normalized to the Renilla luciferase activity to account for differences in transfection efficiencies in different samples. Fold induction following cadmium chloride treatment was calculated for each set by dividing the normalized luciferase activity (firefly luciferase activity divided by the Renilla luciferase activity) in the cadmium treated samples by the normalized luciferase activity in untreated samples. The control represents the fold induction obtained with pGL4.41 reporter co-transfection with empty vector pcDNA3.1- following cadmium chloride treatment.

Real time PCR

RNA was isolated from D. pulicaria at ages 1 week, 4 week, and 8 week using RNazol B (Teltest). cDNA was synthesized as described before using random hexamers [12]. We standardized our real time PCR reactions by performing real time PCRs with serial dilutions of cDNA to ensure appropriate reaction efficiencies. In order for primer sets to be used we set a threshold of 95% efficiency and both primer sets used were within this range (97% for Sirt1, 98% for GAPDH). All reactions were performed in triplicates in a total volume of 20 μl. Reactions included 4 μl cDNA, 250 nM Sirt1 or GAPDH primers, and SsoFast EvaGreen Supermix (BioRad). GAPDH was used for normalization and the primers were same as described by Scoville and Pfrender [63]. All reactions were run on a BioRad CFX96 Real Time System C1000 Thermal cycler machine with the following conditions: 95⁰ C for 30 seconds, 95⁰ C for 5 seconds, 52⁰ C for 5 seconds (the 95 C for 5 seconds and 52 C for 5 second steps are repeated for 40 cycles), 65⁰ C for 5 seconds, and then 95⁰ C for 5 seconds. The data was analyzed using the Bio-Rad CFX Manager Software and used the 2^−ΔΔCt method to compare Sir2 expression in 1, 4, and 8 week RNA samples. Note that 3 separate RNA isolations were used from 3 separate groups of Daphnia to serve as biological replicates. Primer sequences used were as follows:

Real Time Amplicon Sir2

Forward:

5′-GCAGCGAGGATGAAAATCTC-3′

Reverse:

5′-CTCCCAGTCATGATTGCTCA-3′

GAPDH

Forward:

5′-TTATCACCTCCTCAACTTC-3′

Reverse:

5′-CTTCTTCCTTCACTTCTCC-3′

RNAi of Sir2

We created a dsRNA expression construct for the RNAi feeding regimen using the plasmid vector L4440 (AddGene #: 1654, originally a gift to Addgene from Dr. Andrew Fire). We sub-cloned the 5′ half of Daphnia Sir2 ORF in L4440 to express a Sir2 dsRNA of corresponding length (Fig. 5A). This construct would produce a dsRNA of 883 bp corresponding to the 52 half of Sir2 mRNA and thus will target the 52 half of the endogenous transcript. The Sir2/L4440 plasmid was transformed into BL21 (DE3) bacteria, which contain an integrated T7 RNA polymerase under the control of lacUV5 promoter. The bacteria were grown in Luria broth containing 2mM IPTG to induce the expression of the T7 RNA polymerase and consequent production of the Sir2 dsRNA as both strands of the Sir2 ORF are expressed from two opposing T7 promoters in L4440 plasmid. Bacterial cells from 1 ml of the overnight culture (OD₆₀₀ = 2.6) were pelleted and resuspended in 1 ml of COMBO. 500 μl of this suspension was then added daily to the beakers containing the experimental Daphnia. For setting up the experiments, between 7 and 12 Daphnia neonates were collected and grouped per 100 ml of COMBO. Bacterial feed was administered each day, along with 20,000 cells/ml of the algae Ankistrodesmus falcatus. The death and reproductive output of Daphnia were recorded every day until all organisms had perished. Water was changed every other day to ensure no additional growth of bacteria was occurring in beakers and the amount of bacteria consumed was equal each day throughout the course of the experiment. We used two controls, a wild-type control that was not fed on bacteria and a dsRNA control that encodes GFP dsRNA (L4417, AddGene #: 1649, originally a gift to Addgene from Dr. Andrew Fire). GFP dsRNA serves as a control for any effect the presence of dsRNA can potentially exhibit, as there is not endogenous target for GFP dsRNA. To investigate if the knockdown of Sir2 was occurring properly, a separate set of Daphnia of the same age were fed a bacterial RNAi regimen for 10 days. After ten days, the Daphnia were sacrificed for further analysis via Reverse Transcriptase PCR.

Daphnia viability assay following Heat Shock

To determine the ability of Daphnia to cope with proteotoxic stress (specifically heat shock), we standardized the temperature and duration of heat shock such that it elicited death after 24 hours of the heat shock. Ten Daphnia were placed per microcentrifuge tube in 1 ml of water and we had 3 replicates per temperature (total 30 Daphnia with 10 in each tube). The microcentrifuge tube was incubated in a heating block at the designated temperatures for the duration of the heat shock (20 or 30 minutes). Following the heat shock, the Daphnia were placed in 100 ml of COMBO and allowed to recover for 24 hours before analyzing percentage death. Death was determined by visually inspecting the Daphnia under a light microscope to ensure that there was no heartbeat (they have a transparent carapace that makes visual analysis of the heartbeat simple).

Statistics

We performed several statistical tests in order to analyze our results. Either Student T-tests, Chi Square Analysis, Analysis of Variance (ANOVA) (followed by post hoc Tukey test) or nonparametric log rank tests (for survivorship data) were performed depending upon the data (Note: figure captions list which statistical test was performed for each data set). Each figure caption denotes p values as set forth by brackets and special characters. Note that our alpha level for multiple comparisons was p=0.05.

Daphnia cultures

Daphnia pulicaria used in this study were clone 11 isolated from Lake Sixteen (42.564 N, 85.615 W) in Martin, Michigan, USA in 2008 and have since been cultured in the lab. No explicit permission is required to collect Daphnia from lakes that are public access in the state of Michigan. Daphnia are neither endangered nor protected. More details on the source population of D. pulicaria are available in Dudycha 2004 [32]. Daphnia were maintained at a temperature of 20⁰ C with a photoperiod of 12:12 L:D (12 hours of light followed by 12 hours of dark) within a Percival growth chamber. Daphnia were maintained at a concentration of 3 to 5 organisms per 250 mL beaker in 100 mL of COMBO except during RNAi feeding experiments (see below for specific details). Daphnia were cleared of young and transferred to a new beaker with fresh water on every alternate day and were fed every day with vitamin-supplemented algae Ankistrodesmus falcatus at a concentration of 20,000 cells/mL. To generate experimental groups, even-aged cohorts were created by placing neonates individually in 100 ml of COMBO medium [64], which is an artificial lakewater. Experimental animals were otherwise maintained as in the source cultures.