Dihydromyricetin promotes longevity and activates the transcription factors FOXO and AOP in Drosophila

DHM can extend the lifespan of Drosophila

Dihydromyricetin (2R, 3R)-3, 5, 7-trihydroxy-2- (3, 4, 5-trihydroxyphenyl)-2, 3-dihydrochromen-4-one (PubChem CID: 161557 and ChEBI: 28429) is a flavanonol, one of the subgroup of flavonoids (Figure 1A). Lifespan is an important indicator of the aging process. We firstly examined the effects of Drosophila lifespan by adding DHM to diet at concentrations of 0μM, 10μM, 40μM, and 100μM. The result showed that 40μM DHM can extend median lifespan by 16.07% (from 63 days to 72 days), and maximum lifespan of female flies on SYA fully fed (FF) media (Figure 1B, 1C and Supplementary Figure 1A, Supplementary Table 1A). In addition, we also tested whether DHM can extend lifespan in dietary restriction (DR) conditions. When 40μM of DHM was added into DR and FF yeast food media, it did extend the lifespans on both diets (Supplementary Figure 1B). In the following experiments, it is assumed that we chose 40 μM on FF media as the optimal working concentration for the subsequent experiments unless otherwise stated.

To measure whether the lifespan benefits from DHM were indirectly caused by the drug being aversive and/or repellant and thus causing flies to self-impose DR, we assessed the effect of the drug on food ingestion. Used by the dye-labeled food and excreta quantification (EX-Q) method for measuring fly’s food intake, there was no significant difference in food intake between DHM-treated and control group (Figure 1D). During the one hour feeding assay, DHM had no effect on food consumption (Supplementary Figure 1C). This data demonstrated that the lifespan extension by DHM was not dependent on DR.

It is not practical to take the drug during a human’s entire lifetime, therefore we tested the drug effects of only late-life administration on Drosophila. One group was fed FF medium as a control, and another group was fed FF food without DHM for the first 30 days of adult life, after which they were transferred to and maintained on medium containing 40μM of DHM. A further group of flies were fed on medium containing 40μM of DHM for life. We found that lifespan with later-life DHM treatment was significantly extended compared to the control group (Figure 1E and Supplementary Table 1B), however it was not as high as the group with life-long DHM treatment. The later-life DHM treatment increase of median lifespan was 8.474% compared to the life-long increase of 17.80% (Supplementary Table 1B).

Unlike rapamycin or DR treatment, lifespan extension was not associated with a reduction in fecundity [24]. We did not observe significant reduction of fecundity after treatment with DHM (Figure 1F). This result suggests a mode of action that is at least partially distinct from that of rapamycin and DR. Taken together, we demonstrate that DHM can extend the lifespan of Drosophila.

DHM improves stress tolerance, lipid levels and climbing ability

Interventions that extend lifespan are often associated with resistance to various stresses [23], we therefore tested DHM-treated flies for survival under starvation stress. Flies were treated with DHM for 10 days and then transferred to agar-only food for starvation assays. DHM treatment significantly increased survival rates under starvation compared to the control group (Figure 2A and Supplementary Table 2A).

The Triacylglyceride (TAG) level was increased in DHM-treated flies. Even after 48 hours of starvation, DHM-treated flies maintain a high TAG level (Figure 2B). We also used the Oil Red O staining to mark the stored lipid in the gut. Fly guts with DHM treatment show expansion in the oil-red staining area after 14 days (Figure 2C), demonstrating that DHM can increase the lipid store levels in Drosophila. DHM also significantly slowed down the climbing ability declining during aging (Figure 2D). Overall, the addition of DHM can improve the fly’s general health during its lifespan.

DHM slows down gut dysfunction

In both Drosophila and mammals, gut tissue maintenance is extremely important to help maintain physical barrier integrity and appropriate immune function [24, 25]. Gut dysfunction is always associated with aging [26], therefore maintenance of gut homeostasis is very important for animals in slowing down the aging speed. We subsequently investigated the effect of DHM on gut barrier function with the “Smurf” assay [27]. The results show that gut barrier function decreases during the aging process, but that DHM treatment delays this dysfunction (Figure 2E).

Gut microbiota can also become harmful with aging. In aged flies, the load and variety of gut microbes increase, perhaps as a consequence of immune dysregulation. This dysbiosis impairs gut function, ultimately driving mortality [28]. Our previous reports and another study have shown that drugs [27] and DR can delay the microbiota intestinal dysfunction. For this study, we also observed significantly reduced microbiota in the DHM-treated aging guts, but no significant difference of the intestinal microbes in the young flies (Figure 2F). Taken together, all of the data indicates that DHM can maintain intestinal balance during the aging process.

DHM upregulates the activity of FOXO and decreases pAKT

Furthermore, we hope to reveal how DHM regulates healthspan and longevity. Previously, it was reported DHM can downregulate AKT signaling in vitro [29, 30]. AKT is the effector of IIS signaling and can suppress FOXO target expression [31]. Therefore, we checked the phosphorylation level of AKT after treatment with DHM. The result showed that pAKT level did reduce in DHM-treated flies (Figure 3A), indicating that DHM represses AKT signaling in the adult fly. As pAKT can phosphorylate FOXO, and holding it in the cytoplasm, therefore, we checked the FOXO protein in the nucleus of adult gut cells with antibody. We found that the DHM treatment can promote the localization of FOXO in the nucleus (Figure 3B). We also found that consistent with the two target genes of FOXO, Inr and 4ebp were up expressed in the DHM-treated flies compared to the control group (Figure 3C). This demonstrated that DHM can enhance the activity of the transcription factor FOXO.

We also found that fly lifespan was shortened after knock-down of foxo by Da^GS-gal4. Results have showed that flies of DHM treatment extend median lifespan of 10.26% (from 58.5 to 64.5 days), but when knock-down of the foxo the DHM-treated flies only extend median lifespan of 5.21% (from 48 to 50.5 days). That means that knockdown of foxo can partly block the lifespan extension effect of DHM, indicating that DHM can extend lifespan partly dependent on activation of FOXO (Figure 3D). These results also suggest that DHM can modulate pAKT-FOXO signaling activity to slow down aging.

DHM activates AOP via ERK attenuation

Inhibition of RAS-ERK signaling pathway was observed after DHM treatment [32]. Also inhibition of ERK signal activity was considered to be an effective anti-aging strategy [15, 33]. As we showed that knockdown of the foxo just partly blocked the lifespan extension effect of DHM, we then examined whether DHM affects ERK signaling in the process of regulation in aging. We confirmed that the DHM-treated flies significantly decreased the phosphorylation level of ERK by Western blots (Figure 4A). As we know that inhibition of RAS activity promotes the nuclear localization of Anterior open (AOP) in the adult fat body [15]. Therefore, we investigated if there would be AOP expression change after DHM treatment. Our results have shown that DHM led to a significant increase of AOP protein level in the adult fly (Figure 4B). To further assess the transcriptional activity of aop upon treatment with DHM, we also identified the activity of AOP targets. The gene obp99b was thought to be activated by AOP [34] and genes CG1678 and lac were repressed by AOP [15]. Our qPCR results demonstrated that the expression of obp99b significantly increased and the expression of CG1678 and lac significantly decreased in the DHM-treated flies (Figure 4C). These results indicated that DHM modulated the activity of AOP and repressed pERK to enhance health and longevity.

DHM can improve the level of autophagy in Drosophila

Autophagy has an essential role in lifespan extension. Overexpression of atg8a in the neurons and muscle, or overexpression of atg1 in neuron-specific of adult flies can extend their lifespans [35]. FOXO and AOP can regulate the expression of many autophagy-related genes [34]. Therefore, we examined the autophagy levels in the DHM-treated flies. In fly’s midgut epithelial cells, more autophagosomes were detected in DHM-treated guts compared to untreated guts by LysoTracker staining (Figure 5A). When checking the expression of genes by qPCR, we found that the expression levels of atg8a and atg8b were significantly increased in the DHM-treated flies (Figure 5B). These results demonstrated that DHM can increase the level of autophagy in vivo of Drosophila, which is one of the ways to effectively promote longevity.

Fly stocks and husbandry

The wild-type stock Dahomey flies were obtained from UCLA. Da^GS- gal4, foxo-RNAi (CG3143 BL32427) were obtained from the Bloomington Drosophila Stock Center (http://flystocks.bio.indiana.edu). RNAi lines were backcrossed into w¹¹¹⁸ for at least six generations. The males of all RNAi flies were crossed with gal4 virgin females, F1 generation females were collected and after mating, transferred to food containing 200μM RU486 (Mifepristone) for activation. All stocks were maintained at 25° C on a 12 hour: 12 hour light:dark cycle at constant humidity using SYA food [48], at 25° C on a 12 hour:12 hour light:dark cycle at constant humidity. Drugs (RU486, DHM) were added into the food after cooling it to 50° C. For all experiments, flies were reared at standard larval density and enclosed adults were collected over a 12 hour period. Flies were mated for 48 hours before sorting into single sexes.

Antibodies and reagents

Primary antibodies used were as follows: α-Tubulin Antibody (1:2000, Sigma T9026), Rabbit anti-foxo [49] (for this study); pERK (Cell Signaling Technology, 9101); ERK(Cell Signaling Technology, 4695), AOP (Developmental Studies Hybridoma Bank, anti-yan-8b12h9); pAKT (Cell Signaling Technology, 4060); AKT (Cell Signaling Technology, 9272). Mifepristone was purchased from Sigma (M8046 Sigma). DHM (msat-120131108, HPLC≥98 %) was purchased from (Chengdu MUST Bio-Technology Co., Ltd). 30 flies were used to extract protein for Western blots analysis. Western blots were carried out with our standard protocol [27]. The corresponding bands were quantified using ImageJ software. Western blots were performed on three independent biological replicates for each genotype. The relative abundance of α-Tubulin was normalized as a loading control. The student’s t test was used for the statistical analysis.

qRT-PCR

Quantitative real-time polymerase chain reaction (qRT-PCR) was performed as described before [50]. The primers listed as below:

actin5C-5' CTCGCCACTTGCGTTTACAGT

actin5C-3' TCCATATCGTCCCAGTTGGTC

inR-5' CATCGGAAGGGAGGCGTAA

inR-3' CGTTTGCCTAATCGTCGAACA

obp99b-3' GTTGAGGTGCACGAATCGGAC

obp99b-5' AGGCCTTCGTGCAGGAGTCGC

lacosta-5' GCTGTGGTGGTGGAAGTGCT

lacosta-3' GGACCTCCATCCAACCAAAC

CG1678-5' CGGACGCCTCACTCGGAG

CG1678-3' CCCAAGGTGGCAACTCATC

4ebp-5' ACCCTCTACTCCACCACTCC

4ebp-3' GGAGTTTGGCTCAATGGGGA.

Lifespan analysis

Flies that were enclosed over a 48 hours period were collected and allowed to mate for approximately 60 hours. Females were randomly allocated to the experimental food treatments and housed in plastic vials containing food at a density of 10 flies per vial, with 10 vials per condition (n=100). Flies were transferred to a fresh food source 3 times per week, during which any deaths were recorded. DHM was dissolved in ethanol and added to SYA foods at different concentrations. Ethanol alone was added in control food. Food intake assay was carried out as our previous protocol [27]. For most lifespan assays, three independent experiments have been carried out (see Supplementary Tables 1–3).

Smurf assay

Unless stated otherwise, flies were aged on standard/DHM medium until the day of “Smurf” assay [24]. Dyed medium was prepared using standard media with dyes added at a concentration of 2.5% (wt/vol) of Blue dye no.1 (Sigma-Aldrich). Flies were maintained on dyed medium for 9 hours. A fly was counted as a Smurf when dye coloration could be observed outside of the digestive tract. To calculate the Smurf Increase Rate (SIR), we plotted the average proportion of Smurfs per vial as a function of chronological age and defined the SIR as the slope of the calculated regression line.

Immunostaining and fluorescence microscopy

Drosophila guts were analyzed with immunohistochemistry. The immunostaining of intestines was performed as previously described [50]. All images were captured by a Zeiss LSM780 inverted confocal microscope and processed in Adobe Photoshop and Illustrator. The staining pictures were analyzed by the Image Pro.Plus6.0. Intensity quantifications as the median fluorescence intensity of FOXO is divided by the stained median area of DAPI.

Food intake assay

Two methods were used to measure the food intake of Drosophila. One is the excreta quantification (EX-Q) method developed by our lab. Flies were aged on standard/DHM medium until the 10 days, then transferred to the food intake assay medium (Erioglaucine, Sigma 861146, for dye food), and kept on the food intake vials for 24h. Then measured the food intake of flies and the data analysis as the description [51]. The other one is the “one hour feeding assay”. The control and DHM-treated flies in 10 days were used to measure the food intake as the description [52].

Lyso-Tracker staining, imaging, and image analysis

For Lyso-Tracker staining, intact guts were removed from flies that had been maintained on 40μM DHM or control food for 20 days (n=5 flies in each group). Dissections were performed in phosphate buffered saline. Each gut was mounted into a custom-made imaging chamber and stained with 1μM of LysoTracker DS Red DND-99 (Invitrogen, Molecular Probes) for 3 minutes. Each preparation was then washed three times with PBS and mounted in mounting medium (Mounting medium, Vectashield, H1200). Imaging was performed using a fluorescence microscope with ×10 objective and ×10 eyepiece. Numbers of LysoTracker-stained puncta were analyzed by Image Pro.Plus6.0.

Triacylglyceride assay

Flies were fed for 10 days with DHM or a control diet. Each group was divided into six repeats, every repeat containing 10 flies. Flies were then frozen in liquid nitrogen for triacylglyceride content quantification by using Triglyceride assay kit (Nanjing Jiancheng Bioengineering Institute), following the kit protocol.

Oil Red O staining

Flies were fed for 14 days with and without DHM food. Then guts were partially dissected in PBS to expose the inner face of the epidermis and fixed in 4% paraformaldehyde/PBS for 10 min., rinsed twice with distilled water, incubated for 20 to 30 min in Oil Red O stain (6 ml of 0.1% Oil Red O in isopropanol and 4 ml distilled water: prepared fresh and passed through a 0.45-mm syringe filter). After guts were blotted by tissue paper and rinsed twice with distilled water, the stained guts were mounted in glycerol and then scored for large Oil-Red-O positive droplets.

Measurement of vertical climbing ability

Vertical locomotion (climbing) was assessed by the rapid iterative negative geotaxis assay [27]. For each treatment group, 150 flies were placed in 10 vials. The vial was gently shaken until all flies were displaced to the bottom of the vial. Flies were then permitted to climb for 4 seconds and then photographed. Two groups (DHM-fed and controls) were assayed simultaneously. The assay was repeated five times with independent groups of flies. The distance climbed was measured in Adobe Photoshop and the speed was calculated by distances.

Stress assays

For the starvation assay, flies were housed in vials containing 1.5% agarose to provide moisture, but no nutritional value. Deaths were recorded every day [48].

Selective plates for bacterial cultures

10 guts homogenates from flies at 7 or 40 days of age were plated on nutrient-rich medium (NR) or on selective plates allowing growth of Lactobacilli (LMRS), Acetobacteria (ACE), or Enterobacteria (ENT). Selective plates were generated according to the previous recipes [50]. Acetobacteraceae: 25g/L d-mannitol, 5g/L yeast extract, 3g/L peptone, and 15g/L agar. Enterobacteriaceae: 10g/L tryptone, 1.5g/L yeast extract, 10g/L glucose, 5g/L sodium chloride, 12g/L agar. Lactobacilli MRS agar: 70g/L BD Difco Lactobacilli MRS Agar. Nutrient-rich broth: 23g/L BD Difco Nutrient Agar. All media were autoclaved at 121° C for 15 minutes.

Quantification and statistical analysis

Measurements represent the mean of at least three biological replicates in all graphs and error bars represent the standard deviation. As appropriate, log-rank test, student’s t test, one-way ANOVA with post-hoc Dunnett’s test, were used to calculate significance. All statistical analysis was carried out using Graphpad Prism 8.00 software. For all tests, a p<0.05 was considered significant. Asterisks reflecting the calculated p values were shown above each measurement, and ns indicated that differences between measurements were not statistically significant. No data collected were excluded from any experimental or statistical analysis.