Astragalus polysaccharide inhibits the development of urothelial carcinoma by activating AMPK signaling to induce BENC1-xCT complex formation

APS inhibits the proliferation and migration of RT4 and T24 cells

First, we treated RT4 and T24 cells with different concentrations of APS for 24 h. The CCK-8 results revealed that the IC50 values of APS in RT4 and T24 cells were 15.46 and 8.76 μM, respectively (Figure 1A, 1B). Next, we treated RT4 and T24 cells with 15 and 10 μM APS for 24 h. The Transwell results revealed that 15 and 10 μM APS significantly inhibited the migration of RT4 and T24 cells (Figure 1C, 1D). Similarly, scratch assays confirmed that 15 and 10 μM APS significantly reduced the migration of RT4 and T24 cells (Figure 1E, 1F).

Figure 1. APS inhibits the proliferation and migration of RT4 and T24 cells. CCK-8 assays revealed that APS significantly inhibited the viability of RT4 (A) and T24 (B) cells. The transwell results revealed that 15 and 10 μM APS significantly inhibited the migration of RT4 (C) and T24 (D) cells (Bar represents 10 μm, 20 × magnification). Scratch assays confirmed that 15 and 10 μM APS significantly reduced the migration of RT4 (E) and T24 (F) cells (Bar represents 50 μm, 4 × magnification). ^*p < 0.05, ^**p < 0.01 vs. Con.

APS induces ferroptosis in RT4 and T24 cells

We further examined the mechanism by which APS inhibits the proliferation and migration of RT4 and T24 cells. First, RT4 and T24 cells were treated with 1 μM ferrostatin (Fer-1, a ferroptosis inhibitor), 20 μM Z-VAD-FMK (a pancaspase inhibitor), 20 μM necrostatin-1 (Nec-1, a necrosis inhibitor) and 10 μM 3-methyladenine (3-MA, an autophagy inhibitor). Then, RT4 and T24 cells were treated with 15 and 10 μM APS for 24 h. The CCK-8 results showed that 15 and 10 μM APS significantly increased the mortality rates of RT4 and T24 cells (Figure 2A, 2B). In contrast, Fer-1 significantly reversed APS-induced death in RT4 and T24 cells (Figure 2A, 2B). Furthermore, we found that APS significantly increased lipid peroxidation in RT4 and T24 cells, while Fer-1 reversed APS-induced lipid peroxidation in RT4 and T24 cells (Figure 2C).

Figure 2. APS induces ferroptosis in RT4 and T24 cells. RT4 and T24 cells were treated with 1 μM ferrostatin (Fer-1, a ferroptosis inhibitor), 20 μM Z-VAD-FMK (a pancaspase inhibitor), 20 μM necrostatin-1 (Nec-1, a necrosis inhibitor) and 10 μM 3-methyladenine (3-MA, an autophagy inhibitor). Then, RT4 and T24 cells were treated with 15 and 10 μM APS for 24 h. The CCK-8 results showed that Fer-1 significantly reversed APS-induced death in RT4 (A) and T24 (B) cells. (C) C11 BODIPY 581/591 staining revealed that Fer-1 reversed APS-induced lipid peroxidation in RT4 and T24 cells (Bar represents 20 μm, 20 × magnification). ^**p < 0.01, ^***p < 0.001 vs. Con; ^##p < 0.01, ^###p < 0.001 vs. APS.

Fer-1 reverses APS-induced ferroptosis

We examined Fe²⁺ levels in RT4 and T24 cells. APS significantly increased Fe²⁺ accumulation in RT4 and T24 cells, while Fer-1 significantly reduced the APS-induced increase in Fe²⁺ levels (Figure 3A–3C). Moreover, APS increased the lipid oxidation product MDA, while Fer-1 reversed APS-induced MDA accumulation (Figure 3D). In contrast, APS reduced GSH levels in RT4 and T24 cells. Conversely, Fer-1 significantly antagonized the APS-induced decrease in GSH levels (Figure 3E). Additionally, the APS-induced decrease in the viability of RT4 and T24 cells could be improved by Fer-1 (Figure 3F). Flow cytometry revealed that APS increased the mortality of RT4 and T24 cells, while Fer-1 treatment reduced the increase in cell mortality caused by APS (Figure 3G–3J).

Figure 3. Fer-1 reversed APS-induced ferroptosis. (A) FerroOrange staining showed that Fer-1 could reduce the APS-induced increase in Fe²⁺ levels (Bar represents 20 μm, 20 × magnification). (B) Statistical analysis showed that Fer-1 reversed APS-induced Fe²⁺ (C) and MDA (D) accumulation in RT4 and T24 cells. Fer-1 reversed the APS-induced decrease in GSH levels (E) in RT4 and T24 cells. (F) CCK-8 analysis showed that the APS-induced decrease in the viability of RT4 and T24 cells could also be ameliorated by Fer-1. Flow cytometry revealed that Fer-1 treatment reduced the APS-induced increase in the mortality of RT4 (G, H) and (I, J) T24 cells. ^*p < 0.05, ^**p < 0.01, ^***p < 0.001 vs. Con; ^#p < 0.05, ^##p < 0.01, ^###p < 0.001 vs. APS.

APS inhibits xCT activity and reduces GPX4 expression

In RT4 and T24 cells, APS significantly reduced the activity of glutathione peroxidase (Figure 4A). Moreover, the Western blot results revealed that APS did not alter xCT expression in RT4 and T24 cells but reduced GPX4 protein levels (Figure 4B). The IF results showed similar outcomes. xCT fluorescence levels in RT4 and T24 cells were not altered by APS, but GPX4 fluorescence expression was significantly inhibited (Figure 4C). Although APS did not alter the protein expression of xCT, APS reduced the activity of xCT, as evidenced by a decrease in glutamate release (Figure 4D).

Figure 4. APS inhibited the activity of xCT and reduced the expression of GPX4. (A) APS significantly reduced the activity of glutathione peroxidase in RT4 and T24 cells. (B) The Western blot results revealed that APS did not change the expression of xCT in RT4 and T24 cells but reduced the protein level of GPX4. (C) The IF results showed that APS did not change the fluorescence level of xCT but significantly inhibited the fluorescence expression of GPX4 (Bar represents 10 μm, 20 × magnification). (D) APS reduced the activity of xCT in RT4 and T24 cells. ^*p < 0.05, ^**p < 0.01, ^***p < 0.001 vs. Con.

APS activates AMPK/BECN1 signaling in RT4 and T24 cells

A previous study showed that AMPK could phosphorylate BECN1, thereby forming a BECN1-xCT complex that inhibits xCT activity and promotes ferroptosis [13]. Therefore, we examined whether APS activated AMPK/BECN1 signaling in RT4 and T24 cells. In RT4 and T24 cells, APS significantly increased the phosphorylation levels of AMPK and BECN1 (Figure 5A). Further studies revealed the formation of the BECN1-xCT complex in RT4 and T24 cells after APS treatment, as evidenced by enhanced yellow fluorescence (Figure 5B, 5C).

Figure 5. APS activates AMPK/BECN1 signaling in RT4 and T24 cells. (A) The Western blot results showed that APS significantly increased the phosphorylation levels of AMPK and BECN1 in RT4 and T24 cells. IF staining showed that APS induced the formation of the BECN1-xCT complex in RT4 (B) and T24 (C) cells (Bar represents 10 μm, 40 × magnification). ^**p < 0.01, ^***p < 0.001 vs. Con.

Knockdown of AMPK reverses APS-induced ferroptosis

To further verify whether APS-induced ferroptosis was achieved via AMPK signaling, we transfected siRNA targeting AMPK into RT4 and T24 cells. The Western blot results revealed that si-AMPK transfection significantly inhibited AMPK expression in RT4 and T24 cells, even in APS-treated RT4 and T24 cells (Figure 6A). We observed the mitochondrial membrane potential (MMP) changes in mitochondria in RT4 and T24 cells by JC-1 staining. Compared with those in the Con group, APS increased MMP in RT4 and T24 cells, but treatment with si-AMPK reversed such enhancement (Figure 6B). In contrast, silencing AMPK significantly reduced APS-induced MMP upregulation (Figure 6B). Moreover, the APS-induced increase in Fe²⁺ and MDA levels could be alleviated by si-AMPK to some extent (Figure 6C, 6D). Meanwhile, APS decreased GSH levels in RT4 and T24 cells, but knockdown of AMPK could alleviate the reduction of GSH levels (Figure 6E). Accordingly, we hypothesize that APS-induced ferroptosis in RT4 and T24 cells is mediated by AMPK.

Figure 6. Knockdown of AMPK reverses APS-induced ferroptosis. (A) The Western blot results showed that the transfection of si-AMPK significantly inhibited AMPK expression even in APS-treated RT4 and T24 cells. (B) the JC-1 results showed that silencing AMPK significantly ameliorated APS-induced upregulation of MMP (Bar represents 20 μm, 20 × magnification). In RT4 and T24 cells, the APS-induced increase in Fe²⁺ (C) and MDA (D) levels could be alleviated by si-AMPK to some extent. (E) In RT4 and T24 cells, the reduction of GSH induced by APS could be reversed by knockdown of AMPK. ^*p < 0.05, ^***p < 0.001 vs. Con; ^##p < 0.01, ^###p < 0.001 vs. APS.

APS inhibits tumor growth in nude mice in vivo

Next, we examined the effect of APS on tumor growth in nude mice in vivo. As shown in Figure 7A–7C, APS significantly inhibited tumor volume and weight in nude mice. Moreover, APS increased the levels of Fe²⁺ and MDA in tumor tissues (Figure 7D, 7E). In addition, APS decreased the levels of GSH in tumor tissues (Figure 7F). APS increased the mRNA levels of the ferroptosis markers ptgs2 and Chac1 (Figure 7G, 7H). Furthermore, the phosphorylation levels of AMPK and BECN1 were increased in the tumor tissues of nude mice after APS treatment, as confirmed by Western blotting (Figure 7I). In contrast, APS treatment reduced the expression of GPX4 in the tumor tissues of nude mice (Figure 7H).

Figure 7. APS inhibited the growth of tumors in nude mice. (A) Representative images of tumor tissues from nude mice. APS significantly inhibited tumor volume (B) and weight (C) in nude mice. APS increased the levels of Fe²⁺ (D) and MDA (E) in tumor tissues. (F) APS decreased GSH levels in tumor tissues. The RT-PCR results showed that APS increased the mRNA levels of ptgs2 (G) and Chac1 (H) in tumor tissues. (I) After APS treatment, the phosphorylation levels of AMPK and BECN1 were increased in the tumor tissues of nude mice. ^*p < 0.05, ^**p < 0.01, ^***p < 0.001 vs. Con.

Cell culture

The human urothelial cell lines RT4 and T24 were purchased from the American Type Culture Collection (ATCC^® HTB-2™, ATCC^® HTB-4™ and ATCC^® CRL-1573™, respectively). RT4 and T24 cells were cultured in DMEM (HyClone; GE Healthcare Life Sciences, USA) containing 1% penicillin-streptomycin solution (HyClone; GE Healthcare Life Sciences, USA) and 10% fetal bovine serum (FBS, HyClone; GE Healthcare Life Sciences, USA) at 37°C in a humidified incubator with 5% CO₂.

Cell counting Kit-8 (CCK-8) assay

RT4 and T24 cells were inoculated in 96-well plates at 5 × 10³ cells per well and incubated at 37°C until the monolayer was 70% confluent. After that, RT4 and T24 cells were incubated with Astragalus polysaccharide (APS, 89250-26-0, purity >98%, Nanjing Daosif Biotechnology Co., Nanjing, China) at concentrations of 0, 3.125, 6.25, 12.5, 25, and 50 and 0, 0.5, 1, 2, 5, 10, 20, and 30 μM. Cell viability was measured at 48 h according to the instructions of the CCK-8 kit (Beijing Solarbio Science and Technology Co., Ltd., China), and the optical density (OD) at 450 nm was measured and used to calculate the half-inhibitory concentration (IC50) of APS on the cells.

Scratch test

RT4 and T24 cells were inoculated in a 6-well plate, and when the cells were a confluent monolayer, they were randomly divided into the Con and APS (15 and 10 μM) groups, with 3 replicate wells in each group. After that, the cells and debris were washed with PBS and treated with APS for 24 h. The cells were incubated at 37°C for 24 h. Cell migration was observed under a microscope at 0 and 24 h. Wound-healing rate = ((0 h scratch width - 24 h scratch width)/0 h scratch width) × 100%.

Transwell chambers

RT4 and T24 cells were inoculated into the upper chamber of the Transwell (24 wells, Corning, USA) with a pore size of 8 μm (5 × 10⁴ cells per well, and 3 replicate wells for each group) in DMEM without FBS. The cells were treated with 15 and 10 μM APS at 37°C. The lower chamber contained 600 μL of DMEM containing 15% FBS and was incubated at 37°C for 24 h. After the cells penetrated the lower layer of the Transwell, the chamber was removed, and the medium was discarded. The cells in the upper chamber were gently wiped off with a cotton swab, fixed in 4% paraformaldehyde (Beijing Solarbio Science and Technology Co., Ltd., China) and incubated with 0.1% crystal violet (Beijing Solarbio Science and Technology Co., Ltd., China) for 30 min at room temperature. Finally, five randomly selected fields were photographed under a microscope (×20) to observe cell migration.

Measurement of intracellular iron levels

RT4 and T24 cells were inoculated in 6-well plates at a density of 2 × 10⁵/well and incubated at 37°C for 24 h. Afterward, RT4 and T24 cells were treated with 15 and 10 μM APS for 24 h. Intracellular iron levels were measured using an Iron Assay Kit (ab83366, Abcam, UK). The assay was performed in accordance with the instructions. The absorbance of each well at 450 nm was measured using an ELISA microplate reader (ELx800, BioTek, USA).

Malondialdehyde (MDA) assay

RT4 and T24 cells were inoculated in 6-well plates at a density of 2 × 10⁵/well and incubated for 24 h. RT4 and T24 cells were then treated with 15 and 10 μM APS. Intracellular MDA levels were determined using the Lipid Peroxidation (MDA) Assay Kit (ab118970, Abcam, UK). The absorbance of each well was measured at 532 nm using an ELISA microplate reader (ELx800, BioTek, USA).

Reduced glutathione (GSH) assay

RT4 and T24 cells were inoculated in 6-well plates at a density of 2 × 10⁵/well and incubated for 24 h. RT4 and T24 cells were then treated with 15 and 10 μM APS for 24 h. Intracellular GSH levels were measured using GSH and GSSG assay kits (Beyotime, Beijing, China), and the absorbance of each well at 420 nm was measured using an ELISA microplate meter (ELx800, BioTek, USA).

RT-PCR

RT-qPCR was used to determine prostaglandin-endoperoxide synthase 2 (ptgs2) and chaC glutathione specific gamma-glutamylcyclotransferase 1 (chac1) mRNA levels in RT4 and T24 cells, and RNA was extracted from each group of cells according to the SuperScript IV reverse transcription kit (Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA). The mRNA levels of ptgs2 and chac1 in each group of cells were measured by a TaqMan real-time fluorescence PCR kit (Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA). The reaction system was as follows: 9.5 μL RNase Free dH2O, 1 μL cDNA/DNA, 1 μL upstream primer, 1 μL downstream primer, and 12.5 μL 2× UltraSYBR Mixture. GAPDH was used as an internal control. The primer sequences were as follows:

• ptgs2-F: GAGGGATCTGTGGATGCTTCG;

• ptgs2-R: AAACCCACAGTGCTTGACAC;

• chac1-F: CTCAGCCCAGCCATCCATAG;

• chac1-R: CAAGTGGGTAAGAGGCCCAG;

• GAPDH-F: TGACCACAGTCCATGCCATC;

• GAPDH-R: TCCTCTTGTGCTCTTGCTGG.

Western blotting

RT4 and T24 cells were obtained by adding precooled RIPA lysis buffer (Beijing Solarbio Science and Technology Co., Ltd., China), the samples were centrifuged at 4°C for 15 min, and the supernatant was collected. The protein concentration was determined by using a BCA kit (Beijing Solarbio Science and Technology Co., Ltd., China and mixed with 1/4 volume of protein loading buffer (Beijing Solarbio Science and Technology Co., Ltd., China) at 100°C for 5 min. The proteins were separated by electrophoresis using 10% SDS-PAGE. The membranes were incubated with primary antibodies against p-AMPK (Thr172; 50081; 1:1,000; Cell Signaling Technology, Inc., Danvers, MA, USA), AMPK (5831; 1:1,000; Cell Signaling Technology. Inc., Danvers, MA, USA), p-BECN1 (Ser93, 14717; 1:1,000; Cell Signaling Technology, Inc. Technology, Inc., Danvers, MA, USA), GPX4 (59735; 1:1,000; Cell Signaling Technology, Inc., Danvers, MA, USA), xCT (12691; 1:1,000; Cell Signaling Technology, Inc., Danvers, MA, USA), and GAPDH (5174; 1:1,000; Cell Signaling Technology, Inc., Danvers, MA, USA) overnight at 4°C. Then, the membranes were incubated with the secondary antibody (Beijing Solarbio Science and Technology Co., Ltd., China) at a ratio of 1:5000 for 1 h at room temperature. Then, the membranes were washed three times with TBST for 15 min each time. The relative expression of each target protein was calculated by ImageJ 1.43b software (National Institutes of Health, Bethesda, MD, USA), and GAPDH was used as the internal reference.

Flow cytometry

RT4 and T24 cells were inoculated in 6-well plates at a density of 2 × 10⁵/well and incubated for 24 h. RT4 and T24 cells were then treated with 15 and 10 μM APS for 24 h. Then, the cells were collected, and cell death was determined using an Annexin V-PE/7-AAD Apoptosis Detection Kit (Meilunbio Co. Ltd., Dalian, China). The cells were washed once with PBS, washed once with 1× binding buffer, and resuspended in a volume of 100 μl. Then, the cells were incubated with 5 μl Annexin V for 15 min at room temperature and then 5 μl of 1× 7-AAD for 10 min at room temperature. The cells were detected on a CytoFLEX flow cytometer (Beckman Coulter) and the data was analyzed using FlowJo V10 software (Shanghai, China). On the scatter plot of the bivariate flow cytometer, normal cells (AnnexinV-/7-AAD-) were in the lower left quadrant, early apoptotic cells (AnnexinV+/7-AAD-) were in the lower right quadrant, and late apoptotic cells (AnnexinV+/7-AAD+) were in the upper right quadrant.

Transient transfection

The specific siRNA oligonucleotide sequence targeting AMPK was 5′-AAAGTGAAGGTTGGCAAACATGA-3′; the negative control was 5′-UUCUCCGAACGUGUCACGUTT-3′. The specificity of the siRNA oligonucleotide sequence was determined by nucleotide BLAST comparison with all other sequences in GenBank. siRNA transfection was performed using HiPerFect Transfection Reagent (Qiagen, Germany) according to the instructions. For the experiments, RT4 and T24 cells were cultured in six-well plates. Then, 12 μl of HiPerFect Transfection Reagent, 500 ng of siRNA or negative control (NC) RNA, and 100 μl of serum-free DMEM were mixed and added to the wells after standing for 10 min at room temperature.

Lipid peroxidation assay

RT4 and T24 cells were inoculated into 6-well plates and treated with APS for 24 h. After that, the lipophilic fluorescent dye C11 BODIPY 581/591 (1 μM, Shanghai Maokang Biotechnology Co., Ltd., Shanghai, China) was added to RT4 and T24 cells, incubated at 37°C for 30 min and observed under a fluorescence microscope (Keyence, Japan).

FerroOrange staining

RT4 and T24 cells were inoculated into 6-well plates and treated with APS for 24 h. After that, FerroOrange fluorescent dye (2 μM, HY-D1301, MCE, USA) was added to RT4 and T24 cells, incubated at 37°C for 30 min and observed under a fluorescence microscope (Keyence, Japan).

Immunofluorescence staining

Cells were fixed with 4% paraformaldehyde (Beijing Solarbio Science and Technology Co., Ltd., China) at room temperature for 15 min. Subsequently, the cells were washed twice with PBS, permeabilized with 0.4% Triton-X100 (Beijing Solarbio Science and Technology Co., Ltd., China.) for 30 min and blocked with 5% BSA at room temperature for 1 h. The cells were then incubated with primary antibodies against xCT/BECN1/GPX4 at a ratio of 1:100 at 4°C overnight and with secondary antibodies at room temperature for 1 h. The cells were then incubated with DAPI (Beijing Solarbio Science and Technology Co., Ltd., China) for restaining. Images were acquired using fluorescence microscopy and analyzed using ImageJ 1.43b software (National Institutes of Health, Bethesda, MD, USA).

JC-1 staining

Cells were treated as described above. Then, the cells were washed with PBS and stained with 20 μM JC-1 probe (C2006, Beyotime, Beijing, China) at six-well plates for 10 min and observed under a fluorescence microscope immediately.

Glutamate release assay

Glutamate release rate was determined using the Amplex Red Glutamate Release Assay Kit (Thermo Fisher Scientific, A12221) according to the instructions.

Nude mouse tumorigenesis experiment

A total of 10 male nude mice (aged 6~7 weeks) were purchased from Shanghai Jieshige Experimental Animal Co. The mice were housed in a specific pathogen-free (SPF) environment in the central laboratory of Jinzhou Medical University. The experimental design was approved by the Animal Experimentation Ethics Committee of Jinzhou Medical University (Grant No. 2022-053). The mice were fed normal chow, had free access to food and adequate water, and were maintained under a 12 h/12 h light/dark cycle at 24°C with a relative humidity of 40–70%.

RT4 cells in the logarithmic growth phase were washed with sterile PBS and centrifuged at 1,000 r/min (5 min). The supernatant was discarded, and the cells were washed again with sterile PBS and finally resuspended in PBS. After that, 0.1 mL of the cell suspension (2 × 10⁶ cells) was slowly injected into the dorsal subcutis of the mice. After 7 days, the mice were randomly divided into 2 groups, the Con group and the APS group (n = 5 for each group). The nude mice in the APS group were administered 5 mg/kg APS by gavage, and the nude mice in the Con group were administered the same amount of saline once every 3 days. The longest diameter a (mm) and the shortest diameter b (mm) of the tumor were measured once per week, and the tumor volume was determined as follows: V = a × b² × 0.52 (mm³). Mice were anesthetized using 2–3% inhaled isoflurane and the depth of anesthesia was monitored by toe pinch response. The nude mice were sacrificed on Day 21, and the tumor mass was measured.

Statistical analysis

The data were processed using SPSS 25.0 statistical software. p-P plots were used to test the normality of the data, and measures that conformed to a normal distribution are expressed as × ± s. Independent samples t tests were used to compare two groups, and one-way ANOVA followed by post-hoc analysis was used to compare multiple groups. A p < 0.05 was statistically significant.